Construct: shRNA TRCN0000231732

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_754s21c1
DNA Barcode:
ACACTCGGATATTTGATATGT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (-14)
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 754 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 754 5.625 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 754 5.625 N/A
3 human 400673 VMAC vimentin-type intermediate ... NM_001017921.3 89% 3UTR 1053 N/A N/A
4 mouse 102635257 Gm32643 predicted gene, 32643 XR_388237.2 89% 3UTR 7142 N/A N/A
5 mouse 102635257 Gm32643 predicted gene, 32643 XR_405446.2 89% 3UTR 2922 N/A N/A
6 mouse 102635257 Gm32643 predicted gene, 32643 XR_863771.1 89% 3UTR 2805 N/A N/A
7 mouse 102635257 Gm32643 predicted gene, 32643 XR_863772.1 89% 3UTR 2661 N/A N/A
8 mouse 102635257 Gm32643 predicted gene, 32643 XR_863773.1 89% 3UTR 6963 N/A N/A
9 mouse 102635257 Gm32643 predicted gene, 32643 XR_863774.1 89% 3UTR 6944 N/A N/A
10 mouse 102635257 Gm32643 predicted gene, 32643 XR_863775.1 89% 3UTR 7152 N/A N/A
11 mouse 102635257 Gm32643 predicted gene, 32643 XR_863776.1 89% 3UTR 7008 N/A N/A
12 mouse 102635257 Gm32643 predicted gene, 32643 XR_863777.1 89% 3UTR 7107 N/A N/A
13 mouse 102635257 Gm32643 predicted gene, 32643 XR_863778.1 89% 3UTR 2786 N/A N/A
14 mouse 102635257 Gm32643 predicted gene, 32643 XR_863779.1 89% 3UTR 2642 N/A N/A
15 mouse 102635257 Gm32643 predicted gene, 32643 XR_863780.1 89% 3UTR 6989 N/A N/A
16 mouse 102635257 Gm32643 predicted gene, 32643 XR_863781.1 89% 3UTR 2895 N/A N/A
17 mouse 102635257 Gm32643 predicted gene, 32643 XR_863782.1 89% 3UTR 3062 N/A N/A
18 mouse 102635257 Gm32643 predicted gene, 32643 XR_863783.1 89% 3UTR 2972 N/A N/A
19 mouse 102635257 Gm32643 predicted gene, 32643 XR_863784.1 89% 3UTR 3012 N/A N/A
20 mouse 102635257 Gm32643 predicted gene, 32643 XR_879382.1 89% 3UTR 2805 N/A N/A
21 mouse 102635257 Gm32643 predicted gene, 32643 XR_879383.1 89% 3UTR 2661 N/A N/A
22 mouse 102635257 Gm32643 predicted gene, 32643 XR_879384.1 89% 3UTR 6953 N/A N/A
23 mouse 102635257 Gm32643 predicted gene, 32643 XR_879385.1 89% 3UTR 6934 N/A N/A
24 mouse 102635257 Gm32643 predicted gene, 32643 XR_879386.1 89% 3UTR 6998 N/A N/A
25 mouse 102635257 Gm32643 predicted gene, 32643 XR_879387.1 89% 3UTR 7097 N/A N/A
26 mouse 102635257 Gm32643 predicted gene, 32643 XR_879388.1 89% 3UTR 2786 N/A N/A
27 mouse 102635257 Gm32643 predicted gene, 32643 XR_879389.1 89% 3UTR 2642 N/A N/A
28 mouse 102635257 Gm32643 predicted gene, 32643 XR_879390.1 89% 3UTR 6979 N/A N/A
29 mouse 102635257 Gm32643 predicted gene, 32643 XR_879391.1 89% 3UTR 2922 N/A N/A
30 mouse 102635257 Gm32643 predicted gene, 32643 XR_879392.1 89% 3UTR 2895 N/A N/A
31 mouse 102635257 Gm32643 predicted gene, 32643 XR_879393.1 89% 3UTR 3062 N/A N/A
32 mouse 102635257 Gm32643 predicted gene, 32643 XR_879394.1 89% 3UTR 2972 N/A N/A
33 mouse 102635257 Gm32643 predicted gene, 32643 XR_879395.1 89% 3UTR 3012 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACACTCGGATATTTGATATGT
Hairpin Sequence:
5'-CCGG-ACACTCGGATATTTGATATGT-CTCGAG-ACATATCAAATATCCGAGTGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACACTCGGATATTTGATATGTCTCGAGACATATCAAATATCCGAGTGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACACTCGGATATTTGATATGTCTCGAGACATATCAAATATCCGAGTGT-3'

Other clones with same target sequence:

  1. TRCN0000072253