Construct: shRNA TRCN0000231725

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_620s21c1
DNA Barcode:
ACTACACCATCGTGGAACAGT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 620 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 620 3.000 N/A
2 human 6331 SCN5A sodium channel, voltage-gat... NM_000335.4 95% CDS 4312 N/A N/A
3 human 6331 SCN5A sodium channel, voltage-gat... NM_001099404.1 95% CDS 4315 N/A N/A
4 human 6331 SCN5A sodium channel, voltage-gat... NM_001099405.1 95% CDS 4315 N/A N/A
5 human 6331 SCN5A sodium channel, voltage-gat... NM_001160160.1 95% CDS 4313 N/A N/A
6 human 6331 SCN5A sodium channel, voltage-gat... NM_001160161.1 95% CDS 4154 N/A N/A
7 human 6331 SCN5A sodium channel, voltage-gat... NM_198056.2 95% CDS 4315 N/A N/A
8 human 6331 SCN5A sodium channel, voltage-gat... XM_006713282.1 95% CDS 4253 N/A N/A
9 human 6331 SCN5A sodium channel, voltage-gat... XM_006713283.1 95% CDS 4228 N/A N/A
10 human 6331 SCN5A sodium channel, voltage-gat... XM_006713284.1 95% CDS 4309 N/A N/A
11 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516349.1 85% 3UTR 5074 N/A N/A
12 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516350.1 85% 3UTR 4864 N/A N/A
13 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516351.1 85% 3UTR 4848 N/A N/A
14 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516352.1 85% 3UTR 4688 N/A N/A
15 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516353.1 85% 3UTR 4653 N/A N/A
16 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516354.1 85% 3UTR 4672 N/A N/A
17 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516355.1 85% 3UTR 4894 N/A N/A
18 mouse 76044 Ncapg2 non-SMC condensin II comple... XM_006516356.1 85% 3UTR 4491 N/A N/A
19 mouse 20271 Scn5a sodium channel, voltage-gat... NM_001253860.1 89% CDS 4184 N/A N/A
20 mouse 20271 Scn5a sodium channel, voltage-gat... NM_021544.4 89% CDS 4352 N/A N/A
21 mouse 20271 Scn5a sodium channel, voltage-gat... XM_006511993.1 89% CDS 4396 N/A N/A
22 mouse 20271 Scn5a sodium channel, voltage-gat... XM_006511994.1 89% CDS 4396 N/A N/A
23 mouse 20271 Scn5a sodium channel, voltage-gat... XM_006511995.1 89% CDS 4393 N/A N/A
24 mouse 20271 Scn5a sodium channel, voltage-gat... XM_006511996.1 89% CDS 4234 N/A N/A
25 mouse 20271 Scn5a sodium channel, voltage-gat... XM_006511997.1 89% CDS 4366 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACTACACCATCGTGGAACAGT
Hairpin Sequence:
5'-CCGG-ACTACACCATCGTGGAACAGT-CTCGAG-ACTGTTCCACGATGGTGTAGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACTACACCATCGTGGAACAGTCTCGAGACTGTTCCACGATGGTGTAGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACTACACCATCGTGGAACAGTCTCGAGACTGTTCCACGATGGTGTAGT-3'

Other clones with same target sequence:

  1. TRCN0000072213