Construct: shRNA TRCN0000231723

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_621s21c1
DNA Barcode:
CTACACCATCGTGGAACAGTA
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 621 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 621 4.950 N/A
2 human 6331 SCN5A sodium channel, voltage gat... NM_000335.4 89% CDS 4313 N/A N/A
3 human 6331 SCN5A sodium channel, voltage gat... NM_001099404.1 89% CDS 4316 N/A N/A
4 human 6331 SCN5A sodium channel, voltage gat... NM_001099405.1 89% CDS 4316 N/A N/A
5 human 6331 SCN5A sodium channel, voltage gat... NM_001160160.1 89% CDS 4314 N/A N/A
6 human 6331 SCN5A sodium channel, voltage gat... NM_001160161.1 89% CDS 4155 N/A N/A
7 human 6331 SCN5A sodium channel, voltage gat... NM_198056.2 89% CDS 4316 N/A N/A
8 human 6331 SCN5A sodium channel, voltage gat... XM_006713282.2 89% CDS 4254 N/A N/A
9 human 6331 SCN5A sodium channel, voltage gat... XM_011533991.1 89% CDS 4308 N/A N/A
10 human 6331 SCN5A sodium channel, voltage gat... XM_011533992.1 89% CDS 4100 N/A N/A
11 human 105374625 LOC105374625 uncharacterized LOC105374625 XR_925712.1 89% 3UTR 369 N/A N/A
12 human 105374625 LOC105374625 uncharacterized LOC105374625 XR_952485.1 89% 3UTR 369 N/A N/A
13 mouse 192897 Itgb4 integrin beta 4 NM_001005608.2 85% CDS 3083 N/A N/A
14 mouse 192897 Itgb4 integrin beta 4 NM_133663.2 85% CDS 3083 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACACCATCGTGGAACAGTA
Hairpin Sequence:
5'-CCGG-CTACACCATCGTGGAACAGTA-CTCGAG-TACTGTTCCACGATGGTGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACACCATCGTGGAACAGTACTCGAGTACTGTTCCACGATGGTGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACACCATCGTGGAACAGTACTCGAGTACTGTTCCACGATGGTGTAG-3'

Other clones with same target sequence:

  1. TRCN0000072211