Construct: shRNA TRCN0000231718

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_1510s21c1
DNA Barcode:
AGTCAAGTAACAACCGCGAAA
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (-14)
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 1510 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 1510 4.050 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 1510 4.050 N/A
3 mouse 102636202 LOC102636202 uncharacterized LOC102636202 XR_380837.1 89% 3UTR 276 N/A N/A
4 mouse 102636202 LOC102636202 uncharacterized LOC102636202 XR_380838.1 89% 3UTR 183 N/A N/A
5 mouse 102636202 LOC102636202 uncharacterized LOC102636202 XR_393278.1 89% 3UTR 276 N/A N/A
6 mouse 102636202 LOC102636202 uncharacterized LOC102636202 XR_393279.1 89% 3UTR 183 N/A N/A
Download CSV

Sequence Information

Target Sequence:
AGTCAAGTAACAACCGCGAAA
Hairpin Sequence:
5'-CCGG-AGTCAAGTAACAACCGCGAAA-CTCGAG-TTTCGCGGTTGTTACTTGACT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGAGTCAAGTAACAACCGCGAAACTCGAGTTTCGCGGTTGTTACTTGACTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAAGTCAAGTAACAACCGCGAAACTCGAGTTTCGCGGTTGTTACTTGACT-3'

Other clones with same target sequence:

  1. TRCN0000072248