Construct: TRCN0000231716

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_656s21c1
DNA Barcode:
CGACCACGCAAATCAGCGATT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
NCBI lacZ
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 656 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% 100% CDS 656 4.050 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 90% 89% CDS 641 N/A N/A
3 human 491 ATP2B2 plasma membrane Ca(2+)ATPase NM_001001331.2 77% 85% CDS 4102 N/A N/A
4 human 491 ATP2B2 plasma membrane Ca(2+)ATPase NM_001683.3 77% 85% CDS 3967 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGACCACGCAAATCAGCGATT
Hairpin Sequence:
5'-CCGG-CGACCACGCAAATCAGCGATT-CTCGAG-AATCGCTGATTTGCGTGGTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGACCACGCAAATCAGCGATTCTCGAGAATCGCTGATTTGCGTGGTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGACCACGCAAATCAGCGATTCTCGAGAATCGCTGATTTGCGTGGTCG-3'

Other clones with same target sequence:

  1. TRCN0000072233