Construct: TRCN0000231714

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_228s21c1
DNA Barcode:
CAGAATCGTCGTATGCAGTGA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 228 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% 100% CDS 228 2.640 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% 100% CDS 228 2.640 N/A
3 human 305 ANXA2P3 annexin A2 pseudogene 3 NR_001446.2 79% 77% 3UTR 903 N/A N/A
4 mouse 98685 1190005F20Rik N2,N2dimethylguanosine tRNA... NM_026876.3 82% 85% CDS 1510 N/A N/A
5 mouse 74333 A330040F15Rik RIKEN cDNA A330040F15 gene NR_015503.1 85% 89% 3UTR 788 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAGAATCGTCGTATGCAGTGA
Hairpin Sequence:
5'-CCGG-CAGAATCGTCGTATGCAGTGA-CTCGAG-TCACTGCATACGACGATTCTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAGAATCGTCGTATGCAGTGACTCGAGTCACTGCATACGACGATTCTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAGAATCGTCGTATGCAGTGACTCGAGTCACTGCATACGACGATTCTG-3'

Other clones with same target sequence:

  1. TRCN0000072260