Construct: shRNA TRCN0000231701

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_189s21c1
DNA Barcode:
TCAGTTCCAGTACGGCTCCAA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 189 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 189 2.640 N/A
2 human 25963 TMEM87A transmembrane protein 87A NM_015497.3 85% 3UTR 1887 N/A N/A
3 human 339505 LOC339505 uncharacterized LOC339505 NR_033887.1 85% 3UTR 747 N/A N/A
4 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8593 N/A N/A
5 mouse 68401 G6pc3 glucose 6 phosphatase, cata... NM_175935.3 85% 5UTR 11 N/A N/A
6 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141121.1 90% 3UTR 648 N/A N/A
7 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141686.1 90% 3UTR 648 N/A N/A
8 mouse 63830 Kcnq1ot1 KCNQ1 overlapping transcript 1 NR_001461.5 80% 3UTR 26043 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCAGTTCCAGTACGGCTCCAA
Hairpin Sequence:
5'-CCGG-TCAGTTCCAGTACGGCTCCAA-CTCGAG-TTGGAGCCGTACTGGAACTGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCAGTTCCAGTACGGCTCCAACTCGAGTTGGAGCCGTACTGGAACTGA-3'

Other clones with same target sequence:

  1. TRCN0000072204