Construct: shRNA TRCN0000231696

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_403s21c1
DNA Barcode:
GTAATGCAGAAGAAGACCATG
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 403 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 403 4.050 N/A
2 human 55815 TSNAXIP1 translin-associated factor ... NM_001288990.1 89% CDS 1218 N/A N/A
3 human 55815 TSNAXIP1 translin-associated factor ... NM_001288991.1 89% CDS 1011 N/A N/A
4 human 55815 TSNAXIP1 translin-associated factor ... NM_001288992.1 89% 5UTR 884 N/A N/A
5 human 55815 TSNAXIP1 translin-associated factor ... NM_001288993.1 89% 5UTR 1011 N/A N/A
6 human 55815 TSNAXIP1 translin-associated factor ... NM_001288994.1 89% 5UTR 687 N/A N/A
7 human 55815 TSNAXIP1 translin-associated factor ... NM_018430.3 89% CDS 1407 N/A N/A
8 human 55815 TSNAXIP1 translin-associated factor ... XM_005256049.2 89% CDS 1523 N/A N/A
9 human 55815 TSNAXIP1 translin-associated factor ... XM_005256051.1 89% CDS 696 N/A N/A
10 human 55815 TSNAXIP1 translin-associated factor ... XM_005256052.1 89% CDS 883 N/A N/A
11 human 55815 TSNAXIP1 translin-associated factor ... XM_005256053.1 89% CDS 971 N/A N/A
12 human 55815 TSNAXIP1 translin-associated factor ... XM_005256054.1 89% CDS 824 N/A N/A
13 human 55815 TSNAXIP1 translin-associated factor ... XM_006721234.1 89% CDS 697 N/A N/A
14 human 55815 TSNAXIP1 translin-associated factor ... XM_006721235.1 89% CDS 754 N/A N/A
15 mouse 215446 Entpd3 ectonucleoside triphosphate... NM_178676.4 86% 3UTR 1964 N/A N/A
16 mouse 320333 D830030K20Rik RIKEN cDNA D830030K20 gene XR_382955.1 89% 3UTR 730 N/A N/A
17 mouse 320333 D830030K20Rik RIKEN cDNA D830030K20 gene XR_382956.1 89% 3UTR 730 N/A N/A
18 mouse 545007 Gm5796 predicted gene 5796 XM_006518067.1 89% CDS 626 N/A N/A
19 mouse 623078 Gm8108 predicted gene 8108 XR_383051.1 89% 3UTR 459 N/A N/A
20 mouse 622931 Gm10021 predicted gene 10021 XR_032520.3 89% 3UTR 461 N/A N/A
21 mouse 622931 Gm10021 predicted gene 10021 XR_383015.1 89% 3UTR 455 N/A N/A
22 mouse 666800 Gm8297 predicted gene 8297 XR_383027.1 89% 3UTR 1331 N/A N/A
23 mouse 100038847 Gm10406 predicted gene 10406 XM_006517819.1 89% CDS 2531 N/A N/A
24 mouse 100040870 Gm3012 predicted gene 3012 XM_006518262.1 89% CDS 622 N/A N/A
25 mouse 100041774 Gm10413 predicted gene 10413 XM_006517861.1 89% CDS 954 N/A N/A
26 mouse 75827 4930542N06Rik RIKEN cDNA 4930542N06 gene XR_389450.1 85% 3UTR 1789 N/A N/A
27 mouse 75827 4930542N06Rik RIKEN cDNA 4930542N06 gene XR_402723.1 85% 3UTR 1652 N/A N/A
28 mouse 100036569 Gm16525 predicted gene, 16525 XR_382976.1 89% 3UTR 3237 N/A N/A
29 mouse 100036569 Gm16525 predicted gene, 16525 XR_382980.1 89% 3UTR 597 N/A N/A
30 mouse 100042149 Gm3696 predicted gene 3696 XM_006517884.1 89% CDS 812 N/A N/A
31 mouse 102638538 LOC102638538 protein argonaute 12-like XM_006518200.1 89% 3UTR 740 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTAATGCAGAAGAAGACCATG
Hairpin Sequence:
5'-CCGG-GTAATGCAGAAGAAGACCATG-CTCGAG-CATGGTCTTCTTCTGCATTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTAC-3'

Other clones with same target sequence:

  1. TRCN0000072215