Construct: shRNA TRCN0000231696

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_403s21c1
DNA Barcode:
GTAATGCAGAAGAAGACCATG
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 403 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 403 4.050 N/A
2 human 6091 ROBO1 roundabout, axon guidance r... NM_001145845.1 85% CDS 5058 N/A N/A
3 human 6091 ROBO1 roundabout, axon guidance r... NM_002941.3 85% CDS 4568 N/A N/A
4 human 390792 KRT39 keratin 39 NM_213656.3 89% CDS 317 N/A N/A
5 human 55815 TSNAXIP1 translin-associated factor ... NM_018430.2 89% CDS 1178 N/A N/A
6 human 442459 LOC442459 X-ray repair complementing ... NR_024608.1 85% 3UTR 1237 N/A N/A
7 mouse 215446 Entpd3 ectonucleoside triphosphate... NM_178676.4 85% 3UTR 1964 N/A N/A
8 mouse 53617 Krt35 keratin 35 NM_016880.2 89% CDS 322 N/A N/A
9 mouse 406221 Krt40 keratin 40 NM_001039666.1 89% CDS 260 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTAATGCAGAAGAAGACCATG
Hairpin Sequence:
5'-CCGG-GTAATGCAGAAGAAGACCATG-CTCGAG-CATGGTCTTCTTCTGCATTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTAC-3'

Other clones with same target sequence:

  1. TRCN0000072215