Construct: TRCN0000231692

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_612s21c1
DNA Barcode:
CAACGAGGACTACACCATCGT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 612 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 612 2.640 N/A
2 human 9902 MRC2 endocytic receptor (macroph... NM_006039.4 80% 89% CDS 918 N/A N/A
3 mouse 211712 Pcdh9 protocadherin 9 NM_001081377.1 79% 81% CDS 2424 N/A N/A
4 mouse 105841 Dennd3 DENN/MADD domain containing 3 NM_001081066.1 77% 85% CDS 591 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAACGAGGACTACACCATCGT
Hairpin Sequence:
5'-CCGG-CAACGAGGACTACACCATCGT-CTCGAG-ACGATGGTGTAGTCCTCGTTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAACGAGGACTACACCATCGTCTCGAGACGATGGTGTAGTCCTCGTTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAACGAGGACTACACCATCGTCTCGAGACGATGGTGTAGTCCTCGTTG-3'

Other clones with same target sequence:

  1. TRCN0000072217