Construct: TRCN0000231689

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_576s21c1
DNA Barcode:
CTACAAGACCGACATCAAGCT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 576 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 576 2.640 N/A
2 human 4843 NOS2 NOS, type II NM_000625.4 81% 85% CDS 2491 N/A N/A
3 human 10313 RTN3 ASY interacting protein NM_006054.2 86% 85% CDS 484 N/A N/A
4 human 10313 RTN3 ASY interacting protein NM_201428.1 86% 85% CDS 2815 N/A N/A
5 human 10313 RTN3 ASY interacting protein NM_201429.1 86% 85% CDS 541 N/A N/A
6 human 10313 RTN3 ASY interacting protein NM_201430.1 86% 85% CDS 484 N/A N/A
7 human 283459 GATC glutamyltRNA(Gln) amidotran... NR_033684.1 77% 85% 3UTR 3806 N/A N/A
8 human 648987 LOC648987 uncharacterized LOC648987 NR_034085.1 81% 85% 3UTR 2431 N/A N/A
9 mouse 11687 Alox15 arachidonate 15-lipoxygenase NM_009660.3 90% 89% CDS 1475 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACAAGACCGACATCAAGCT
Hairpin Sequence:
5'-CCGG-CTACAAGACCGACATCAAGCT-CTCGAG-AGCTTGATGTCGGTCTTGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACAAGACCGACATCAAGCTCTCGAGAGCTTGATGTCGGTCTTGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACAAGACCGACATCAAGCTCTCGAGAGCTTGATGTCGGTCTTGTAG-3'

Other clones with same target sequence:

  1. TRCN0000072219