Construct: shRNA TRCN0000231688

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_336s21c1
DNA Barcode:
CCTGCAGGACGGCGAGTTCAT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 336 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 336 0.000 N/A
2 human 55083 KIF26B kinesin family member 26B NM_018012.3 89% CDS 2294 N/A N/A
3 human 55083 KIF26B kinesin family member 26B XM_011544214.1 89% CDS 1446 N/A N/A
4 human 55083 KIF26B kinesin family member 26B XM_011544215.1 89% CDS 1628 N/A N/A
5 human 55083 KIF26B kinesin family member 26B XM_011544216.1 89% CDS 1554 N/A N/A
6 human 55083 KIF26B kinesin family member 26B XM_011544217.1 89% CDS 1742 N/A N/A
7 human 55083 KIF26B kinesin family member 26B XM_011544218.1 89% CDS 1069 N/A N/A
8 human 729359 PLIN4 perilipin 4 NM_001080400.1 89% CDS 3597 N/A N/A
9 human 729359 PLIN4 perilipin 4 XM_006722866.1 89% CDS 3772 N/A N/A
10 human 729359 PLIN4 perilipin 4 XM_006722868.2 89% CDS 3769 N/A N/A
11 human 729359 PLIN4 perilipin 4 XM_011528233.1 89% CDS 3952 N/A N/A
12 human 729359 PLIN4 perilipin 4 XM_011528234.1 89% CDS 3943 N/A N/A
13 human 729359 PLIN4 perilipin 4 XM_011528235.1 89% CDS 3933 N/A N/A
14 human 729359 PLIN4 perilipin 4 XM_011528236.1 89% CDS 3656 N/A N/A
15 human 729359 PLIN4 perilipin 4 XM_011528237.1 89% CDS 3557 N/A N/A
16 mouse 67224 Med29 mediator complex subunit 29 NM_026042.3 85% 3UTR 1681 N/A N/A
17 mouse 72045 2010001E11Rik RIKEN cDNA 2010001E11 gene NM_001163503.1 89% 5UTR 66 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCTGCAGGACGGCGAGTTCAT
Hairpin Sequence:
5'-CCGG-CCTGCAGGACGGCGAGTTCAT-CTCGAG-ATGAACTCGCCGTCCTGCAGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGG-3'

Other clones with same target sequence:

(none)