Construct: TRCN0000231688

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_336s21c1
DNA Barcode:
CCTGCAGGACGGCGAGTTCAT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 336 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 336 0.000 N/A
2 human 5705 PSMC5 MSUG1 protein NM_001199163.1 86% 85% CDS 1326 N/A N/A
3 human 5705 PSMC5 MSUG1 protein NM_002805.5 86% 85% CDS 1191 N/A N/A
4 human 55083 KIF26B kinesin family member 26B NM_018012.3 80% 89% CDS 2294 N/A N/A
5 human 729359 PLIN4 plasma membrane associated ... NM_001080400.1 80% 89% CDS 3597 N/A N/A
6 mouse 67224 Med29 intersexlike NM_026042.3 77% 85% 3UTR 1681 N/A N/A
7 mouse 72045 2010001E11Rik hypothetical protein LOC72045 NM_001163503.1 80% 89% 5UTR 66 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCTGCAGGACGGCGAGTTCAT
Hairpin Sequence:
5'-CCGG-CCTGCAGGACGGCGAGTTCAT-CTCGAG-ATGAACTCGCCGTCCTGCAGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCTGCAGGACGGCGAGTTCATCTCGAGATGAACTCGCCGTCCTGCAGG-3'

Other clones with same target sequence:

(none)