Construct: shRNA TRCN0000231687

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_407s21c1
DNA Barcode:
TGCAGAAGAAGACCATGGGCT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 407 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 407 0.660 N/A
2 human 23304 UBR2 ubiquitin protein ligase E3... NM_015255.2 89% 3UTR 6107 N/A N/A
3 human 122953 JDP2 Jun dimerization protein 2 NM_001135047.1 80% CDS 546 N/A N/A
4 human 122953 JDP2 Jun dimerization protein 2 NM_001135048.1 80% CDS 538 N/A N/A
5 human 122953 JDP2 Jun dimerization protein 2 NM_001135049.1 80% CDS 705 N/A N/A
6 human 122953 JDP2 Jun dimerization protein 2 NM_130469.3 80% CDS 752 N/A N/A
7 human 124222 PAQR4 progestin and adipoQ recept... NM_152341.3 89% 3UTR 2060 N/A N/A
8 human 389072 PLEKHM3 pleckstrin homology domain ... NM_001080475.2 85% CDS 1506 N/A N/A
9 human 84074 QRICH2 glutamine rich 2 NM_032134.1 85% CDS 312 N/A N/A
10 human 56907 SPIRE1 spire homolog 1 (Drosophila) NM_001128626.1 89% CDS 575 N/A N/A
11 human 56907 SPIRE1 spire homolog 1 (Drosophila) NM_001128627.1 89% CDS 273 N/A N/A
12 human 100652948 LOC100652948 uncharacterized LOC100652948 XR_132783.1 85% 3UTR 18 N/A N/A
13 human 100653287 LOC100653287 uncharacterized LOC100653287 XR_132946.1 85% 3UTR 18 N/A N/A
14 mouse 75753 Klf17 Kruppel-like factor 17 NM_029416.2 89% 3UTR 2885 N/A N/A
15 mouse 230866 C230096C10Rik RIKEN cDNA C230096C10 gene NM_001039200.1 89% CDS 2351 N/A N/A
16 mouse 230866 C230096C10Rik RIKEN cDNA C230096C10 gene NM_146157.3 89% CDS 2360 N/A N/A
17 mouse 28064 Yipf3 Yip1 domain family, member 3 NM_145353.2 89% CDS 372 N/A N/A
18 mouse 100415784 Gm17830 predicted gene, 17830 NR_033486.1 85% 3UTR 1482 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCAGAAGAAGACCATGGGCT
Hairpin Sequence:
5'-CCGG-TGCAGAAGAAGACCATGGGCT-CTCGAG-AGCCCATGGTCTTCTTCTGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCA-3'

Other clones with same target sequence:

  1. TRCN0000072221