Construct: shRNA TRCN0000231687

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_407s21c1
DNA Barcode:
TGCAGAAGAAGACCATGGGCT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 407 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 407 0.660 N/A
2 human 23304 UBR2 ubiquitin protein ligase E3... NM_015255.2 89% 3UTR 6107 N/A N/A
3 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248965.3 89% 3UTR 6168 N/A N/A
4 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248966.2 89% 3UTR 3774 N/A N/A
5 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514438.1 89% 3UTR 5826 N/A N/A
6 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514439.1 89% 3UTR 4674 N/A N/A
7 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514440.1 89% 3UTR 4674 N/A N/A
8 human 23304 UBR2 ubiquitin protein ligase E3... XM_011514441.1 89% 3UTR 4288 N/A N/A
9 human 124222 PAQR4 progestin and adipoQ recept... NM_001284511.1 89% 3UTR 2039 N/A N/A
10 human 124222 PAQR4 progestin and adipoQ recept... NM_001284512.1 89% 3UTR 1934 N/A N/A
11 human 124222 PAQR4 progestin and adipoQ recept... NM_001284513.1 89% 3UTR 1662 N/A N/A
12 human 124222 PAQR4 progestin and adipoQ recept... NM_152341.4 89% 3UTR 2156 N/A N/A
13 human 124222 PAQR4 progestin and adipoQ recept... XM_005255112.1 89% 3UTR 1859 N/A N/A
14 human 84074 QRICH2 glutamine rich 2 NM_032134.2 86% CDS 312 N/A N/A
15 human 84074 QRICH2 glutamine rich 2 NR_130649.1 86% 3UTR 312 N/A N/A
16 human 84074 QRICH2 glutamine rich 2 XM_005257728.2 86% CDS 1322 N/A N/A
17 human 56907 SPIRE1 spire-type actin nucleation... XM_011525703.1 89% CDS 645 N/A N/A
18 human 105376751 LOC105376751 uncharacterized LOC105376751 XR_933149.1 90% 3UTR 219 N/A N/A
19 human 105371109 LOC105371109 uncharacterized LOC105371109 XR_916959.1 90% 3UTR 219 N/A N/A
20 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_916951.1 90% 3UTR 219 N/A N/A
21 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_933139.1 90% 3UTR 219 N/A N/A
22 human 105371105 LOC105371105 uncharacterized LOC105371105 XR_951934.1 90% 3UTR 219 N/A N/A
23 human 105378467 LOC105378467 uncharacterized LOC105378467 XR_946289.1 85% 3UTR 61 N/A N/A
24 human 105378467 LOC105378467 uncharacterized LOC105378467 XR_959843.1 85% 3UTR 61 N/A N/A
25 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_916923.1 90% 3UTR 223 N/A N/A
26 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_933125.1 90% 3UTR 223 N/A N/A
27 human 105371097 LOC105371097 uncharacterized LOC105371097 XR_951911.1 90% 3UTR 223 N/A N/A
28 mouse 75753 Klf17 Kruppel-like factor 17 NM_029416.2 89% 3UTR 2885 N/A N/A
29 mouse 83762 Otof otoferlin NM_001100395.1 85% CDS 645 N/A N/A
30 mouse 230866 Emc1 ER membrane protein complex... NM_001039200.2 89% CDS 2357 N/A N/A
31 mouse 230866 Emc1 ER membrane protein complex... NM_146157.4 89% CDS 2366 N/A N/A
32 mouse 28064 Yipf3 Yip1 domain family, member 3 NM_145353.2 89% CDS 372 N/A N/A
33 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_006524377.2 89% CDS 382 N/A N/A
34 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_006524378.2 89% 5UTR 331 N/A N/A
35 mouse 100415784 Gm17830 predicted gene, 17830 NR_033486.1 85% 3UTR 1482 N/A N/A
36 mouse 102640311 Gm36410 predicted gene, 36410 XR_383497.2 89% 3UTR 83 N/A N/A
37 mouse 102640311 Gm36410 predicted gene, 36410 XR_395906.2 89% 3UTR 83 N/A N/A
38 mouse 105245196 LOC105245196 uncharacterized LOC105245196 XR_871798.1 90% 3UTR 3781 N/A N/A
39 mouse 105245196 LOC105245196 uncharacterized LOC105245196 XR_871799.1 90% 3UTR 3781 N/A N/A
40 mouse 105245196 LOC105245196 uncharacterized LOC105245196 XR_871800.1 90% 3UTR 3781 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCAGAAGAAGACCATGGGCT
Hairpin Sequence:
5'-CCGG-TGCAGAAGAAGACCATGGGCT-CTCGAG-AGCCCATGGTCTTCTTCTGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCA-3'

Other clones with same target sequence:

  1. TRCN0000072221