Construct: shRNA TRCN0000231686

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_190s21c1
DNA Barcode:
CAGTTCCAGTACGGCTCCAAG
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 190 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 190 1.350 N/A
2 mouse 75956 Srrm2 serine/arginine repetitive ... NM_175229.3 89% CDS 6930 N/A N/A
3 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525076.1 89% CDS 7242 N/A N/A
4 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525077.1 89% CDS 7119 N/A N/A
5 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525078.1 89% CDS 7243 N/A N/A
6 mouse 75956 Srrm2 serine/arginine repetitive ... XM_006525079.1 89% CDS 7248 N/A N/A
7 mouse 75956 Srrm2 serine/arginine repetitive ... XR_385381.1 89% 3UTR 7248 N/A N/A
8 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8594 N/A N/A
9 mouse 11789 Apc adenomatosis polyposis coli XM_006525529.1 89% CDS 9068 N/A N/A
10 mouse 11789 Apc adenomatosis polyposis coli XM_006525530.1 89% CDS 8648 N/A N/A
11 mouse 11789 Apc adenomatosis polyposis coli XM_006525531.1 89% CDS 8435 N/A N/A
12 mouse 11789 Apc adenomatosis polyposis coli XM_006525532.1 89% CDS 9013 N/A N/A
13 mouse 11789 Apc adenomatosis polyposis coli XM_006525533.1 89% CDS 8408 N/A N/A
14 mouse 11789 Apc adenomatosis polyposis coli XM_006525534.1 89% CDS 8963 N/A N/A
15 mouse 11789 Apc adenomatosis polyposis coli XM_006525535.1 89% CDS 8457 N/A N/A
16 mouse 11789 Apc adenomatosis polyposis coli XM_006525536.1 89% CDS 8453 N/A N/A
17 mouse 11789 Apc adenomatosis polyposis coli XM_006525537.1 89% CDS 8433 N/A N/A
18 mouse 11789 Apc adenomatosis polyposis coli XM_006525538.1 89% CDS 8764 N/A N/A
19 mouse 11789 Apc adenomatosis polyposis coli XM_006525539.1 89% CDS 8291 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAGTTCCAGTACGGCTCCAAG
Hairpin Sequence:
5'-CCGG-CAGTTCCAGTACGGCTCCAAG-CTCGAG-CTTGGAGCCGTACTGGAACTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTG-3'

Other clones with same target sequence:

(none)