Construct: shRNA TRCN0000231686

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_190s21c1
DNA Barcode:
CAGTTCCAGTACGGCTCCAAG
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 190 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 190 1.350 N/A
2 mouse 75956 Srrm2 serine/arginine repetitive ... NM_175229.3 89% CDS 6930 N/A N/A
3 mouse 11789 Apc adenomatosis polyposis coli NM_007462.3 89% CDS 8594 N/A N/A
4 mouse 68401 G6pc3 glucose 6 phosphatase, cata... NM_175935.3 90% 5UTR 12 N/A N/A
5 mouse 66350 Pla2g12a phospholipase A2, group XIIA NM_023196.3 77% CDS 485 N/A N/A
6 mouse 66350 Pla2g12a phospholipase A2, group XIIA NM_183423.2 77% CDS 284 N/A N/A
7 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141121.1 85% 3UTR 649 N/A N/A
8 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141686.1 85% 3UTR 649 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CAGTTCCAGTACGGCTCCAAG
Hairpin Sequence:
5'-CCGG-CAGTTCCAGTACGGCTCCAAG-CTCGAG-CTTGGAGCCGTACTGGAACTG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACAGTTCCAGTACGGCTCCAAGCTCGAGCTTGGAGCCGTACTGGAACTG-3'

Other clones with same target sequence:

(none)