Construct: TRCN0000231685

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_1932s21c1
DNA Barcode:
GTTCCGTCATAGCGATAACGA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
NCBI lacZ
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 1932 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% 100% CDS 1932 3.000 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 100% 100% CDS 1917 3.000 N/A
3 human 125144 C17orf76-AS1 hypothetical protein LOC125144 NR_027161.1 77% 85% 3UTR 432 N/A N/A
4 human 125144 C17orf76-AS1 hypothetical protein LOC125144 NR_027162.1 77% 85% 3UTR 432 N/A N/A
5 human 125144 C17orf76-AS1 hypothetical protein LOC125144 NR_027163.1 77% 85% 3UTR 166 N/A N/A
6 human 125144 C17orf76-AS1 hypothetical protein LOC125144 NR_027169.1 77% 85% 3UTR 166 N/A N/A
7 human 125144 C17orf76-AS1 hypothetical protein LOC125144 NR_045026.1 77% 85% 3UTR 166 N/A N/A
8 human 692087 SNORD49B small nucleolar RNA, C/D bo... NR_003043.1 77% 85% 3UTR 23 N/A N/A
9 human 26800 SNORD49A small nucleolar RNA, C/D bo... NR_002744.1 77% 85% 3UTR 27 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTTCCGTCATAGCGATAACGA
Hairpin Sequence:
5'-CCGG-GTTCCGTCATAGCGATAACGA-CTCGAG-TCGTTATCGCTATGACGGAAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTTCCGTCATAGCGATAACGACTCGAGTCGTTATCGCTATGACGGAACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTTCCGTCATAGCGATAACGACTCGAGTCGTTATCGCTATGACGGAAC-3'

Other clones with same target sequence:

  1. TRCN0000072238