Construct: shRNA TRCN0000231684

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_198s21c1
DNA Barcode:
GTACGGCTCCAAGGCCTACGT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 198 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 198 0.000 N/A
2 human 4249 MGAT5 mannosyl (alpha-1,6-)-glyco... NM_002410.4 85% 3UTR 4960 N/A N/A
3 human 4249 MGAT5 mannosyl (alpha-1,6-)-glyco... XM_005263666.2 85% 3UTR 5621 N/A N/A
4 mouse 22625 Map3k19 mitogen-activated protein k... XM_006529396.1 81% CDS 3271 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTACGGCTCCAAGGCCTACGT
Hairpin Sequence:
5'-CCGG-GTACGGCTCCAAGGCCTACGT-CTCGAG-ACGTAGGCCTTGGAGCCGTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTACGGCTCCAAGGCCTACGTCTCGAGACGTAGGCCTTGGAGCCGTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTACGGCTCCAAGGCCTACGTCTCGAGACGTAGGCCTTGGAGCCGTAC-3'

Other clones with same target sequence:

(none)