Construct: TRCN0000231683

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_188s21c1
DNA Barcode:
CTCAGTTCCAGTACGGCTCCA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 188 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 188 0.720 N/A
2 human 286094 LOC286094 uncharacterized LOC286094 NR_026706.1 77% 85% 3UTR 538 N/A N/A
3 human 339505 LOC339505 uncharacterized LOC339505 NR_033887.1 86% 85% 3UTR 746 N/A N/A
4 human 155184 SLC2A7 intestinal facilitative glu... NM_207420.2 86% 85% CDS 99 N/A N/A
5 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141121.1 81% 85% 3UTR 647 N/A N/A
6 mouse 667148 Gm8482 predicted pseudogene 8482 XR_141686.1 81% 85% 3UTR 647 N/A N/A
7 mouse 63830 Kcnq1ot1 KCNQ1 overlapping transcript 1 NR_001461.5 82% 80% 3UTR 26042 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTCAGTTCCAGTACGGCTCCA
Hairpin Sequence:
5'-CCGG-CTCAGTTCCAGTACGGCTCCA-CTCGAG-TGGAGCCGTACTGGAACTGAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTCAGTTCCAGTACGGCTCCACTCGAGTGGAGCCGTACTGGAACTGAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTCAGTTCCAGTACGGCTCCACTCGAGTGGAGCCGTACTGGAACTGAG-3'

Other clones with same target sequence:

  1. TRCN0000072209