Construct: shRNA TRCN0000223035

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-395s1c1
DNA Barcode:
GCGTGATCTTCACCGACAAGA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
tGFP (-11)
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 395 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 395 4.950 N/A
2 mouse 20928 Abcc9 ATP-binding cassette, sub-f... NM_001044720.1 89% 3UTR 4824 N/A N/A
3 mouse 20928 Abcc9 ATP-binding cassette, sub-f... NM_021041.2 89% 3UTR 4863 N/A N/A
4 mouse 20928 Abcc9 ATP-binding cassette, sub-f... NM_021042.2 89% 3UTR 4758 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGTGATCTTCACCGACAAGA
Hairpin Sequence:
5'-CCGG-GCGTGATCTTCACCGACAAGA-CTCGAG-TCTTGTCGGTGAAGATCACGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGTGATCTTCACCGACAAGACTCGAGTCTTGTCGGTGAAGATCACGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGTGATCTTCACCGACAAGACTCGAGTCTTGTCGGTGAAGATCACGC-3'

Other clones with same target sequence:

(none)