Construct: shRNA TRCN0000222901

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-406s1c1
DNA Barcode:
ACCGACAAGATCATCCGCAGC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 406 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 406 0.400 N/A
2 human 5580 PRKCD protein kinase C, delta NM_006254.3 89% CDS 954 N/A N/A
3 human 5580 PRKCD protein kinase C, delta NM_212539.1 89% CDS 842 N/A N/A
4 human 286336 FAM78A family with sequence simila... NM_033387.3 85% CDS 941 N/A N/A
5 mouse 20847 Stat2 signal transducer and activ... NM_019963.1 85% CDS 2071 N/A N/A
6 mouse 208104 Mlxip MLX interacting protein NM_133917.2 80% CDS 326 N/A N/A
7 mouse 208104 Mlxip MLX interacting protein NM_177582.2 80% CDS 326 N/A N/A
8 mouse 545384 BC094916 cDNA sequence BC094916 NM_001024721.2 85% CDS 843 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACCGACAAGATCATCCGCAGC
Hairpin Sequence:
5'-CCGG-ACCGACAAGATCATCCGCAGC-CTCGAG-GCTGCGGATGATCTTGTCGGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGT-3'

Other clones with same target sequence:

(none)