Construct: shRNA TRCN0000222901

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-406s1c1
DNA Barcode:
ACCGACAAGATCATCCGCAGC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 406 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 406 0.400 N/A
2 human 5580 PRKCD protein kinase C, delta NM_006254.3 89% CDS 954 N/A N/A
3 human 5580 PRKCD protein kinase C, delta NM_212539.1 89% CDS 842 N/A N/A
4 human 5580 PRKCD protein kinase C, delta XM_006713257.1 89% CDS 685 N/A N/A
5 human 5580 PRKCD protein kinase C, delta XM_006713258.1 89% CDS 787 N/A N/A
6 human 5580 PRKCD protein kinase C, delta XM_006713259.1 89% CDS 1060 N/A N/A
7 mouse 20847 Stat2 signal transducer and activ... XM_006513433.1 85% CDS 2089 N/A N/A
8 mouse 20847 Stat2 signal transducer and activ... XM_006513434.1 85% CDS 2089 N/A N/A
9 mouse 20847 Stat2 signal transducer and activ... XM_006513435.1 85% CDS 1989 N/A N/A
10 mouse 20847 Stat2 signal transducer and activ... XM_006513436.1 85% 3UTR 2169 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACCGACAAGATCATCCGCAGC
Hairpin Sequence:
5'-CCGG-ACCGACAAGATCATCCGCAGC-CTCGAG-GCTGCGGATGATCTTGTCGGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACCGACAAGATCATCCGCAGCCTCGAGGCTGCGGATGATCTTGTCGGT-3'

Other clones with same target sequence:

(none)