Construct: shRNA TRCN0000222885

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-179s1c1
DNA Barcode:
GCCACGTGATGGGCTACGGCT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 179 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 179 0.000 N/A
Download CSV

Sequence Information

Target Sequence:
GCCACGTGATGGGCTACGGCT
Hairpin Sequence:
5'-CCGG-GCCACGTGATGGGCTACGGCT-CTCGAG-AGCCGTAGCCCATCACGTGGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCCACGTGATGGGCTACGGCTCTCGAGAGCCGTAGCCCATCACGTGGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCCACGTGATGGGCTACGGCTCTCGAGAGCCGTAGCCCATCACGTGGC-3'

Other clones with same target sequence:

(none)