Construct: shRNA TRCN0000222866

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-531s1c1
DNA Barcode:
GGACAGCCACATGCACTTCAA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
tGFP (-11)
Gene Description:
turboGfp
Transcript:
Broad turboGfp.1 (CURRENT)
Match location:
Position 531 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 531 4.950 N/A
2 human 26150 RIBC2 RIB43A domain with coiled-c... XM_011530126.1 85% 5UTR 128 N/A N/A
3 human 169693 TMEM252 transmembrane protein 252 NM_153237.1 95% 3UTR 940 N/A N/A
4 human 169693 TMEM252 transmembrane protein 252 XM_011518330.1 95% 3UTR 959 N/A N/A
5 human 55122 AKIRIN2 akirin 2 NM_018064.3 89% CDS 920 N/A N/A
6 human 101060405 LOC101060405 putative RRN3-like protein ... XM_011508577.1 90% 3UTR 1020 N/A N/A
7 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_947597.1 89% 3UTR 1097 N/A N/A
8 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_947598.1 89% 3UTR 1097 N/A N/A
9 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_958304.1 89% 3UTR 1097 N/A N/A
10 human 105378855 LOC105378855 uncharacterized LOC105378855 XR_958305.1 89% 3UTR 1097 N/A N/A
11 mouse 226250 Afap1l2 actin filament associated p... NM_001177796.1 89% CDS 1591 N/A N/A
12 mouse 226250 Afap1l2 actin filament associated p... NM_001177797.1 89% CDS 1537 N/A N/A
13 mouse 226250 Afap1l2 actin filament associated p... NM_146102.2 89% CDS 1643 N/A N/A
14 mouse 226250 Afap1l2 actin filament associated p... XM_006527024.2 89% CDS 1690 N/A N/A
15 mouse 226250 Afap1l2 actin filament associated p... XM_006527025.2 89% CDS 1635 N/A N/A
16 mouse 226250 Afap1l2 actin filament associated p... XM_006527027.2 89% CDS 1684 N/A N/A
17 mouse 69726 Smyd3 SET and MYND domain contain... XM_006496981.2 85% 5UTR 2107 N/A N/A
18 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_875052.1 89% 3UTR 200 N/A N/A
19 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_875053.1 89% 3UTR 200 N/A N/A
20 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_875054.1 89% 3UTR 170 N/A N/A
21 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_880636.1 89% 3UTR 200 N/A N/A
22 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_880637.1 89% 3UTR 200 N/A N/A
23 mouse 105245896 LOC105245896 uncharacterized LOC105245896 XR_880638.1 89% 3UTR 170 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GGACAGCCACATGCACTTCAA
Hairpin Sequence:
5'-CCGG-GGACAGCCACATGCACTTCAA-CTCGAG-TTGAAGTGCATGTGGCTGTCC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCC-3'

Other clones with same target sequence:

(none)