Construct: TRCN0000222866

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-531s1c1
DNA Barcode:
GGACAGCCACATGCACTTCAA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 531 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% 100% CDS 531 4.950 N/A
2 human 169693 C9orf71 hypothetical protein LOC169693 NM_153237.1 85% 94% 3UTR 940 N/A N/A
3 human 55122 AKIRIN2 OTTHUMP00000016836 NM_018064.3 80% 89% CDS 920 N/A N/A
4 human 25792 CIZ1 CDKN1Ainteracting zinc fing... NM_001131016.1 81% 85% CDS 1298 N/A N/A
5 human 25792 CIZ1 CDKN1Ainteracting zinc fing... NM_012127.2 81% 85% CDS 1338 N/A N/A
6 human 100652978 LOC100652978 uncharacterized LOC100652978 XR_132794.1 86% 85% 3UTR 336 N/A N/A
7 human 100653134 LOC100653134 uncharacterized LOC100653134 XR_133243.1 86% 85% 3UTR 336 N/A N/A
8 mouse 226250 Afap1l2 actin filament associated p... NM_001177796.1 85% 89% CDS 1591 N/A N/A
9 mouse 226250 Afap1l2 actin filament associated p... NM_001177797.1 85% 89% CDS 1537 N/A N/A
10 mouse 226250 Afap1l2 actin filament associated p... NM_146102.2 85% 89% CDS 1643 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GGACAGCCACATGCACTTCAA
Hairpin Sequence:
5'-CCGG-GGACAGCCACATGCACTTCAA-CTCGAG-TTGAAGTGCATGTGGCTGTCC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCC-3'

Other clones with same target sequence:

(none)