Construct: shRNA TRCN0000222866

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-531s1c1
DNA Barcode:
GGACAGCCACATGCACTTCAA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
tGFP (-11)
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 531 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 531 4.950 N/A
2 human 169693 TMEM252 transmembrane protein 252 NM_153237.1 95% 3UTR 940 N/A N/A
3 human 55122 AKIRIN2 akirin 2 NM_018064.3 89% CDS 920 N/A N/A
4 mouse 226250 Afap1l2 actin filament associated p... NM_001177796.1 89% CDS 1591 N/A N/A
5 mouse 226250 Afap1l2 actin filament associated p... NM_001177797.1 89% CDS 1537 N/A N/A
6 mouse 226250 Afap1l2 actin filament associated p... NM_146102.2 89% CDS 1643 N/A N/A
7 mouse 226250 Afap1l2 actin filament associated p... XM_006527024.1 89% CDS 1691 N/A N/A
8 mouse 226250 Afap1l2 actin filament associated p... XM_006527025.1 89% CDS 1636 N/A N/A
9 mouse 226250 Afap1l2 actin filament associated p... XM_006527026.1 89% CDS 1215 N/A N/A
10 mouse 226250 Afap1l2 actin filament associated p... XM_006527027.1 89% CDS 1685 N/A N/A
11 mouse 69726 Smyd3 SET and MYND domain contain... XM_006496981.1 85% 5UTR 747 N/A N/A
12 mouse 102635175 Gm32578 predicted gene, 32578 XR_387030.1 89% 3UTR 3934 N/A N/A
13 mouse 102635175 Gm32578 predicted gene, 32578 XR_406417.1 89% 3UTR 3934 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GGACAGCCACATGCACTTCAA
Hairpin Sequence:
5'-CCGG-GGACAGCCACATGCACTTCAA-CTCGAG-TTGAAGTGCATGTGGCTGTCC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGGACAGCCACATGCACTTCAACTCGAGTTGAAGTGCATGTGGCTGTCC-3'

Other clones with same target sequence:

(none)