Construct: shRNA TRCN0000222819

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-510s1c1
DNA Barcode:
CGGCTACTACAGCTCCGTGGT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 510 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 510 0.000 N/A
2 human 57521 RPTOR regulatory associated prote... NM_001163034.1 89% CDS 4294 N/A N/A
3 human 57521 RPTOR regulatory associated prote... NM_020761.2 89% CDS 4768 N/A N/A
4 human 3239 HOXD13 homeobox D13 NM_000523.3 90% CDS 486 N/A N/A
5 human 9719 ADAMTSL2 ADAMTS-like 2 NM_001145320.1 89% CDS 2522 N/A N/A
6 human 9719 ADAMTSL2 ADAMTS-like 2 NM_014694.3 89% CDS 2180 N/A N/A
7 human 339855 KY kyphoscoliosis peptidase NM_178554.4 89% 3UTR 3450 N/A N/A
8 human 3083 HGFAC HGF activator NM_001528.2 89% CDS 1647 N/A N/A
9 mouse 117146 Ube3b ubiquitin protein ligase E3B NM_054093.2 89% CDS 2917 N/A N/A
10 mouse 219140 Spata13 spermatogenesis associated 13 NM_001033272.1 77% CDS 3835 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGCTACTACAGCTCCGTGGT
Hairpin Sequence:
5'-CCGG-CGGCTACTACAGCTCCGTGGT-CTCGAG-ACCACGGAGCTGTAGTAGCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGCTACTACAGCTCCGTGGTCTCGAGACCACGGAGCTGTAGTAGCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGCTACTACAGCTCCGTGGTCTCGAGACCACGGAGCTGTAGTAGCCG-3'

Other clones with same target sequence:

(none)