Construct: shRNA TRCN0000222803

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-170s1c1
DNA Barcode:
ACCTGCTGAGCCACGTGATGG
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 170 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 170 0.000 N/A
2 human 114822 RHPN1 rhophilin, Rho GTPase bindi... NM_052924.2 85% 3UTR 2299 N/A N/A
3 human 144132 DNHD1 dynein heavy chain domain 1 NM_144666.2 89% CDS 13928 N/A N/A
4 human 3706 ITPKA inositol-trisphosphate 3-ki... NM_002220.2 85% CDS 489 N/A N/A
5 human 123720 WHAMM WAS protein homolog associa... NM_001080435.1 81% CDS 2582 N/A N/A
6 mouse 19766 Ripk1 receptor (TNFRSF)-interacti... NM_009068.3 89% CDS 2070 N/A N/A
7 mouse 240066 Zfp870 zinc finger protein 870 NM_207245.2 80% 3UTR 2014 N/A N/A
8 mouse 217364 Engase endo-beta-N-acetylglucosami... NM_172573.2 77% CDS 376 N/A N/A
9 mouse 74748 Slamf8 SLAM family member 8 NM_029084.3 89% 3UTR 1024 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACCTGCTGAGCCACGTGATGG
Hairpin Sequence:
5'-CCGG-ACCTGCTGAGCCACGTGATGG-CTCGAG-CCATCACGTGGCTCAGCAGGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACCTGCTGAGCCACGTGATGGCTCGAGCCATCACGTGGCTCAGCAGGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACCTGCTGAGCCACGTGATGGCTCGAGCCATCACGTGGCTCAGCAGGT-3'

Other clones with same target sequence:

(none)