Construct: shRNA TRCN0000222796

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-523s1c1
DNA Barcode:
TCCGTGGTGGACAGCCACATG
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
tGFP (-11)
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 523 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% CDS 523 0.000 N/A
2 human 1014 CDH16 cadherin 16, KSP-cadherin NM_001204744.1 89% CDS 2355 N/A N/A
3 human 1014 CDH16 cadherin 16, KSP-cadherin NM_001204745.1 89% CDS 2304 N/A N/A
4 human 1014 CDH16 cadherin 16, KSP-cadherin NM_001204746.1 89% CDS 2130 N/A N/A
5 human 1014 CDH16 cadherin 16, KSP-cadherin NM_004062.3 89% CDS 2421 N/A N/A
6 human 1014 CDH16 cadherin 16, KSP-cadherin XM_005255768.2 89% CDS 2690 N/A N/A
7 human 1014 CDH16 cadherin 16, KSP-cadherin XM_005255769.2 89% CDS 2768 N/A N/A
8 human 1014 CDH16 cadherin 16, KSP-cadherin XM_005255770.2 89% CDS 2312 N/A N/A
9 human 2936 GSR glutathione reductase NM_000637.3 89% CDS 405 N/A N/A
10 human 2936 GSR glutathione reductase NM_001195102.1 89% CDS 405 N/A N/A
11 human 2936 GSR glutathione reductase NM_001195103.1 89% CDS 405 N/A N/A
12 human 2936 GSR glutathione reductase NM_001195104.1 89% CDS 405 N/A N/A
13 human 54825 CDHR2 cadherin-related family mem... XM_006714887.1 85% CDS 703 N/A N/A
14 mouse 14917 Gucy2c guanylate cyclase 2c NM_001127318.1 89% CDS 1994 N/A N/A
15 mouse 14917 Gucy2c guanylate cyclase 2c NM_145067.3 89% CDS 1922 N/A N/A
16 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_006513230.1 81% CDS 552 N/A N/A
17 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_006513231.1 81% CDS 549 N/A N/A
18 mouse 14598 Ggt1 gamma-glutamyltransferase 1 XM_006513232.1 81% CDS 468 N/A N/A
19 mouse 240672 Dusp5 dual specificity phosphatase 5 NM_001085390.1 89% CDS 685 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCCGTGGTGGACAGCCACATG
Hairpin Sequence:
5'-CCGG-TCCGTGGTGGACAGCCACATG-CTCGAG-CATGTGGCTGTCCACCACGGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGA-3'

Other clones with same target sequence:

(none)