Construct: TRCN0000222796

Construct Description:

Construct Type:
shRNA
Other Identifiers:
turboGfp-523s1c1
DNA Barcode:
TCCGTGGTGGACAGCCACATG
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
evrogen tGFP
Gene Description:
turboGfp
Transcript:
evrogen turboGfp.1 (CURRENT)
Match location:
Position 523 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -11 tGFP turboGfp turboGfp.1 100% 100% CDS 523 0.000 N/A
2 human 1014 CDH16 KSPcadherin NM_001204744.1 80% 89% CDS 2355 N/A N/A
3 human 1014 CDH16 KSPcadherin NM_001204745.1 80% 89% CDS 2304 N/A N/A
4 human 1014 CDH16 KSPcadherin NM_001204746.1 80% 89% CDS 2130 N/A N/A
5 human 1014 CDH16 KSPcadherin NM_004062.3 80% 89% CDS 2421 N/A N/A
6 human 2936 GSR glutathione reductase NM_000637.3 85% 89% CDS 405 N/A N/A
7 human 2936 GSR glutathione reductase NM_001195102.1 85% 89% CDS 405 N/A N/A
8 human 2936 GSR glutathione reductase NM_001195103.1 85% 89% CDS 405 N/A N/A
9 human 2936 GSR glutathione reductase NM_001195104.1 85% 89% CDS 405 N/A N/A
10 mouse 14917 Gucy2c STA receptor NM_001127318.1 90% 89% CDS 1994 N/A N/A
11 mouse 14917 Gucy2c STA receptor NM_145067.3 90% 89% CDS 1922 N/A N/A
12 mouse 14598 Ggt1 gammaglutamyl transpeptidase NM_008116.2 73% 80% CDS 344 N/A N/A
13 mouse 240672 Dusp5 dual specificity phosphatase 5 NM_001085390.1 80% 89% CDS 685 N/A N/A
14 mouse 227885 Gm13498 predicted gene 13498 NR_033595.1 82% 80% 3UTR 1775 N/A N/A
15 mouse 320534 Tmem104 novel transmembrane amino a... NM_001033393.2 90% 89% CDS 1166 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCCGTGGTGGACAGCCACATG
Hairpin Sequence:
5'-CCGG-TCCGTGGTGGACAGCCACATG-CTCGAG-CATGTGGCTGTCCACCACGGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCCGTGGTGGACAGCCACATGCTCGAGCATGTGGCTGTCCACCACGGA-3'

Other clones with same target sequence:

(none)