Construct: TRCN0000208001

Construct Description:

Construct Type:
Neg. Control
Other Identifiers:
pLKO.1-emptyT
DNA Barcode:
ACACTCGAGCACTTTTTGAAT
Vector:
pLKO.1

Sequence Information:

Vector insert sequence:
5'-CCGG-ACACTCGAGCACTTTTTG-AATT-3'

Other non-shRNA clones in this vector:

  1. TRCN0000241922
  2. TRCN0000204879