Construct: TRCN0000207257

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_21s1c1
DNA Barcode:
GCTGTTCACCGGGGTGGTGCC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 21 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 21 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 21 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 21 0.000 N/A
4 human 1844 DUSP2 dualspecificity phosphatase 2 NM_004418.3 86% 85% CDS 1019 N/A N/A
5 human 7472 WNT2 secreted growth factor NR_024047.1 77% 85% 3UTR 1583 N/A N/A
6 mouse 17263 Meg3 maternally expressed 3 NR_003633.2 86% 85% 3UTR 11317 N/A N/A
7 mouse 17263 Meg3 maternally expressed 3 NR_027651.1 86% 85% 3UTR 11305 N/A N/A
8 mouse 319582 6430573F11Rik hypothetical protein LOC319582 NM_176952.4 77% 85% 3UTR 1442 N/A N/A
9 mouse 100041089 Gm3134 predicted gene 3134 XR_106150.2 81% 85% 3UTR 551 N/A N/A
10 mouse 100041089 Gm3134 predicted gene 3134 XR_108020.2 81% 85% 3UTR 551 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCTGTTCACCGGGGTGGTGCC
Hairpin Sequence:
5'-CCGG-GCTGTTCACCGGGGTGGTGCC-CTCGAG-GGCACCACCCCGGTGAACAGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCTGTTCACCGGGGTGGTGCCCTCGAGGGCACCACCCCGGTGAACAGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCTGTTCACCGGGGTGGTGCCCTCGAGGGCACCACCCCGGTGAACAGC-3'

Other clones with same target sequence:

(none)