Construct: shRNA TRCN0000207257

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_21s1c1
DNA Barcode:
GCTGTTCACCGGGGTGGTGCC
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 21 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 21 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 21 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 21 0.000 N/A
4 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene NM_176952.4 85% 3UTR 1442 N/A N/A
5 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509133.1 85% 3UTR 2159 N/A N/A
6 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509134.1 85% 3UTR 2075 N/A N/A
7 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509135.1 85% 3UTR 1894 N/A N/A
8 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509136.1 85% 3UTR 2086 N/A N/A
9 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509137.1 85% 3UTR 1236 N/A N/A
10 mouse 319582 6430573F11Rik RIKEN cDNA 6430573F11 gene XM_006509138.1 85% 3UTR 2095 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCTGTTCACCGGGGTGGTGCC
Hairpin Sequence:
5'-CCGG-GCTGTTCACCGGGGTGGTGCC-CTCGAG-GGCACCACCCCGGTGAACAGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCTGTTCACCGGGGTGGTGCCCTCGAGGGCACCACCCCGGTGAACAGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCTGTTCACCGGGGTGGTGCCCTCGAGGGCACCACCCCGGTGAACAGC-3'

Other clones with same target sequence:

(none)