Construct: shRNA TRCN0000207114

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_616s1c1
DNA Barcode:
TCCGCCCTGAGCAAAGACCCC
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
Broad clonetechGfp.1 (CURRENT)
Match location:
Position 616 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 616 0.000 N/A
2 CONTROL -40 BFP Hahn Lab BFP BFP.1 100% CDS 616 0.000 N/A
3 CONTROL -44 eGFP Hahn Lab eGFP eGFP.1 100% CDS 616 0.000 N/A
4 human 92595 ZNF764 zinc finger protein 764 NM_001172679.1 89% CDS 782 N/A N/A
5 human 92595 ZNF764 zinc finger protein 764 NM_033410.3 89% CDS 785 N/A N/A
6 human 65988 ZNF747 zinc finger protein 747 NM_001305018.1 89% CDS 958 N/A N/A
7 human 65988 ZNF747 zinc finger protein 747 NM_001305019.1 89% CDS 955 N/A N/A
8 human 65988 ZNF747 zinc finger protein 747 NM_001305020.1 89% 3UTR 1095 N/A N/A
9 human 65988 ZNF747 zinc finger protein 747 NM_023931.3 89% 3UTR 1098 N/A N/A
10 mouse 105242528 LOC105242528 uncharacterized LOC105242528 XR_862410.1 89% 3UTR 1085 N/A N/A
11 mouse 105242528 LOC105242528 uncharacterized LOC105242528 XR_881916.1 89% 3UTR 1085 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCCGCCCTGAGCAAAGACCCC
Hairpin Sequence:
5'-CCGG-TCCGCCCTGAGCAAAGACCCC-CTCGAG-GGGGTCTTTGCTCAGGGCGGA-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCCGCCCTGAGCAAAGACCCCCTCGAGGGGGTCTTTGCTCAGGGCGGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCCGCCCTGAGCAAAGACCCCCTCGAGGGGGTCTTTGCTCAGGGCGGA-3'

Other clones with same target sequence:

(none)