Construct: shRNA TRCN0000207114

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_616s1c1
DNA Barcode:
TCCGCCCTGAGCAAAGACCCC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 616 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 616 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 616 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 616 0.000 N/A
4 human 92595 ZNF764 zinc finger protein 764 NM_001172679.1 89% CDS 782 N/A N/A
5 human 92595 ZNF764 zinc finger protein 764 NM_033410.3 89% CDS 785 N/A N/A
6 human 65988 ZNF747 zinc finger protein 747 NM_023931.2 89% 3UTR 1001 N/A N/A
7 mouse 100503631 Gm19805 predicted gene, 19805 XR_105524.1 85% 3UTR 14 N/A N/A
8 mouse 100503631 Gm19805 predicted gene, 19805 XR_106769.1 85% 3UTR 14 N/A N/A
9 mouse 100504141 Gm20083 predicted gene, 20083 XR_105118.1 77% 3UTR 666 N/A N/A
10 mouse 100504141 Gm20083 predicted gene, 20083 XR_107912.1 77% 3UTR 666 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCCGCCCTGAGCAAAGACCCC
Hairpin Sequence:
5'-CCGG-TCCGCCCTGAGCAAAGACCCC-CTCGAG-GGGGTCTTTGCTCAGGGCGGA-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCCGCCCTGAGCAAAGACCCCCTCGAGGGGGTCTTTGCTCAGGGCGGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCCGCCCTGAGCAAAGACCCCCTCGAGGGGGTCTTTGCTCAGGGCGGA-3'

Other clones with same target sequence:

(none)