Construct: shRNA TRCN0000207065

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_647s1c1
DNA Barcode:
GCGATCACATGGTCCTGCTGG
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 647 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 647 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 647 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 647 0.000 N/A
4 human 79770 TXNDC15 thioredoxin domain containi... NM_024715.3 89% CDS 921 N/A N/A
5 human 9572 NR1D1 nuclear receptor subfamily ... NM_021724.3 90% 5UTR 14 N/A N/A
6 human 100506376 TTLL10-AS1 TTLL10 antisense RNA 1 (non... XR_132470.1 75% 3UTR 2185 N/A N/A
7 human 100506376 TTLL10-AS1 TTLL10 antisense RNA 1 (non... XR_133245.1 75% 3UTR 2185 N/A N/A
8 human 100509256 LOC100509256 uncharacterized LOC100509256 XR_113292.2 85% 3UTR 256 N/A N/A
9 mouse 258482 Olfr266 olfactory receptor 266 NM_146489.1 90% CDS 478 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGATCACATGGTCCTGCTGG
Hairpin Sequence:
5'-CCGG-GCGATCACATGGTCCTGCTGG-CTCGAG-CCAGCAGGACCATGTGATCGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGATCACATGGTCCTGCTGGCTCGAGCCAGCAGGACCATGTGATCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGATCACATGGTCCTGCTGGCTCGAGCCAGCAGGACCATGTGATCGC-3'

Other clones with same target sequence:

(none)