Construct: shRNA TRCN0000207020

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_186s1c1
DNA Barcode:
GACCACCCTGACCTACGGCGT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 186 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 186 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 89% CDS 186 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 186 0.000 N/A
4 human 124602 KIF19 kinesin family member 19 NM_153209.3 89% CDS 1140 N/A N/A
5 human 124602 KIF19 kinesin family member 19 XM_005257029.1 89% CDS 1140 N/A N/A
6 human 124602 KIF19 kinesin family member 19 XM_005257030.1 89% CDS 1014 N/A N/A
7 mouse 69564 Nmrk2 nicotinamide riboside kinase 2 NM_027120.2 89% CDS 106 N/A N/A
8 mouse 17910 Myo15 myosin XV NM_001103171.1 81% CDS 1142 N/A N/A
9 mouse 17910 Myo15 myosin XV NM_010862.2 81% CDS 1142 N/A N/A
10 mouse 17910 Myo15 myosin XV XM_006532427.1 81% CDS 2161 N/A N/A
11 mouse 17910 Myo15 myosin XV XM_006532428.1 81% CDS 2160 N/A N/A
12 mouse 286942 Kif19a kinesin family member 19A NM_001102615.1 89% CDS 1127 N/A N/A
13 mouse 286942 Kif19a kinesin family member 19A XM_006533507.1 89% CDS 1481 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GACCACCCTGACCTACGGCGT
Hairpin Sequence:
5'-CCGG-GACCACCCTGACCTACGGCGT-CTCGAG-ACGCCGTAGGTCAGGGTGGTC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGACCACCCTGACCTACGGCGTCTCGAGACGCCGTAGGTCAGGGTGGTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGACCACCCTGACCTACGGCGTCTCGAGACGCCGTAGGTCAGGGTGGTC-3'

Other clones with same target sequence:

(none)