Construct: shRNA TRCN0000206973

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_243s1c1
DNA Barcode:
GCACGACTTCTTCAAGTCCGC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 243 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 243 0.018 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 243 0.018 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 243 0.018 N/A
4 human 6916 TBXAS1 thromboxane A synthase 1 (p... NR_029394.1 85% 3UTR 1120 N/A N/A
5 human 100128593 LOC100128593 uncharacterized LOC100128593 NR_033913.1 85% 3UTR 446 N/A N/A
6 mouse 18503 Pax1 paired box gene 1 NM_008780.2 89% 3UTR 1896 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCACGACTTCTTCAAGTCCGC
Hairpin Sequence:
5'-CCGG-GCACGACTTCTTCAAGTCCGC-CTCGAG-GCGGACTTGAAGAAGTCGTGC-TTTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCACGACTTCTTCAAGTCCGCCTCGAGGCGGACTTGAAGAAGTCGTGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCACGACTTCTTCAAGTCCGCCTCGAGGCGGACTTGAAGAAGTCGTGC-3'

Other clones with same target sequence:

(none)