Construct: shRNA TRCN0000072267

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_34s1c1
DNA Barcode:
GCGCCATTCTATCCGCTGGAA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 34 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 34 0.880 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 34 0.880 N/A
3 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037127.2 85% CDS 2507 N/A N/A
4 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037128.1 85% CDS 2462 N/A N/A
5 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037129.1 85% CDS 2438 N/A N/A
6 mouse 18198 Musk muscle, skeletal, receptor ... NM_001037130.1 85% CDS 2408 N/A N/A
7 mouse 18198 Musk muscle, skeletal, receptor ... NM_010944.2 85% CDS 2432 N/A N/A
8 mouse 18198 Musk muscle, skeletal, receptor ... XM_006537659.1 85% CDS 2729 N/A N/A
9 mouse 18198 Musk muscle, skeletal, receptor ... XM_006537660.1 85% CDS 2622 N/A N/A
10 mouse 18198 Musk muscle, skeletal, receptor ... XM_006537661.1 85% CDS 2705 N/A N/A
11 mouse 230959 Ajap1 adherens junction associate... NM_001099299.1 90% CDS 702 N/A N/A
12 mouse 230959 Ajap1 adherens junction associate... XM_006538824.1 90% CDS 326 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGCCATTCTATCCGCTGGAA
Hairpin Sequence:
5'-CCGG-GCGCCATTCTATCCGCTGGAA-CTCGAG-TTCCAGCGGATAGAATGGCGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGCCATTCTATCCGCTGGAACTCGAGTTCCAGCGGATAGAATGGCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGCCATTCTATCCGCTGGAACTCGAGTTCCAGCGGATAGAATGGCGC-3'

Other clones with same target sequence:

  1. TRCN0000231731