Construct: shRNA TRCN0000072266

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_743s1c1
DNA Barcode:
GAATGTTTACTACACTCGGAT

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (-14)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 743 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072266)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 743 2.640 N/A
2 CONTROL -43 Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 743 2.640 N/A
3 mouse 80797 Clca3a2 chloride channel accessory 3A2 NM_030601.3 81% 3UTR 2790 N/A N/A
4 mouse 80797 Clca3a2 chloride channel accessory 3A2 XM_011240289.1 81% 3UTR 2816 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAATGTTTACTACACTCGGAT
Hairpin Sequence:
5'-CCGG-GAATGTTTACTACACTCGGAT-CTCGAG-ATCCGAGTGTAGTAAACATTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAATGTTTACTACACTCGGATCTCGAGATCCGAGTGTAGTAAACATTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAATGTTTACTACACTCGGATCTCGAGATCCGAGTGTAGTAAACATTC-3'

Other clones with same target sequence:

  1. TRCN0000231729