Construct: shRNA TRCN0000072266

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_743s1c1
DNA Barcode:
GAATGTTTACTACACTCGGAT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 743 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 743 2.640 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 743 2.640 N/A
3 human 100130231 LOC100130231 uncharacterized LOC100130231 NR_038446.1 85% 3UTR 2427 N/A N/A
4 mouse 80797 Clca2 chloride channel calcium ac... NM_030601.3 80% 3UTR 2790 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAATGTTTACTACACTCGGAT
Hairpin Sequence:
5'-CCGG-GAATGTTTACTACACTCGGAT-CTCGAG-ATCCGAGTGTAGTAAACATTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAATGTTTACTACACTCGGATCTCGAGATCCGAGTGTAGTAAACATTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAATGTTTACTACACTCGGATCTCGAGATCCGAGTGTAGTAAACATTC-3'

Other clones with same target sequence:

  1. TRCN0000231729