Construct: shRNA TRCN0000072265

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_1546s1c1
DNA Barcode:
GTTGTGTTTGTGGACGAAGTA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (-14)
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 1546 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 1546 4.950 N/A
2 CONTROL -38 luc2 gi 115342883 bases 141-1793... luc2.1 89% CDS 1546 N/A N/A
3 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 1546 4.950 N/A
4 mouse 117599 Helb helicase (DNA) B NM_080446.2 89% CDS 1799 N/A N/A
5 mouse 102631854 LOC102631854 uncharacterized LOC102631854 XR_388191.1 85% 3UTR 1691 N/A N/A
6 mouse 102631854 LOC102631854 uncharacterized LOC102631854 XR_388193.1 85% 3UTR 1496 N/A N/A
7 mouse 102631854 LOC102631854 uncharacterized LOC102631854 XR_388194.1 85% 3UTR 1246 N/A N/A
8 mouse 102631854 LOC102631854 uncharacterized LOC102631854 XR_405396.1 85% 3UTR 1691 N/A N/A
9 mouse 102631854 LOC102631854 uncharacterized LOC102631854 XR_405398.1 85% 3UTR 1246 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTTGTGTTTGTGGACGAAGTA
Hairpin Sequence:
5'-CCGG-GTTGTGTTTGTGGACGAAGTA-CTCGAG-TACTTCGTCCACAAACACAAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTTGTGTTTGTGGACGAAGTACTCGAGTACTTCGTCCACAAACACAACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTTGTGTTTGTGGACGAAGTACTCGAGTACTTCGTCCACAAACACAAC-3'

Other clones with same target sequence:

  1. TRCN0000231727