Construct: shRNA TRCN0000072265

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_1546s1c1
DNA Barcode:
GTTGTGTTTGTGGACGAAGTA

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 1546 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072265)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 1546 4.950 N/A
2 CONTROL luc2 luc2 gi 115342883 bases 141-1793... luc2.1 89% CDS 1546 N/A N/A
3 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 1546 4.950 N/A
4 mouse 117599 Helb helicase (DNA) B NM_080446.2 89% CDS 1799 N/A N/A
5 mouse 102631854 Gm30081 predicted gene, 30081 XR_405396.1 85% 3UTR 1691 N/A N/A
6 mouse 102631854 Gm30081 predicted gene, 30081 XR_863735.1 85% 3UTR 2926 N/A N/A
7 mouse 102631854 Gm30081 predicted gene, 30081 XR_863737.1 85% 3UTR 2830 N/A N/A
8 mouse 102631854 Gm30081 predicted gene, 30081 XR_879342.1 85% 3UTR 3148 N/A N/A
9 mouse 102631854 Gm30081 predicted gene, 30081 XR_879344.1 85% 3UTR 2927 N/A N/A
10 mouse 102631854 Gm30081 predicted gene, 30081 XR_879345.1 85% 3UTR 1912 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTTGTGTTTGTGGACGAAGTA
Hairpin Sequence:
5'-CCGG-GTTGTGTTTGTGGACGAAGTA-CTCGAG-TACTTCGTCCACAAACACAAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTTGTGTTTGTGGACGAAGTACTCGAGTACTTCGTCCACAAACACAACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTTGTGTTTGTGGACGAAGTACTCGAGTACTTCGTCCACAAACACAAC-3'

Other clones with same target sequence:

  1. TRCN0000231727