Construct: shRNA TRCN0000072263

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_164s1c1
DNA Barcode:
AGTACTTCGAAATGTCCGTTC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 164 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 164 2.250 N/A
2 CONTROL -18 hlucPlus gi 42718122 bases 2532-4184... hlucPlus.1 89% CDS 164 N/A N/A
Download CSV

Sequence Information

Target Sequence:
AGTACTTCGAAATGTCCGTTC
Hairpin Sequence:
5'-CCGG-AGTACTTCGAAATGTCCGTTC-CTCGAG-GAACGGACATTTCGAAGTACT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGAGTACTTCGAAATGTCCGTTCCTCGAGGAACGGACATTTCGAAGTACTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAAGTACTTCGAAATGTCCGTTCCTCGAGGAACGGACATTTCGAAGTACT-3'

Other clones with same target sequence:

  1. TRCN0000231739