Construct: shRNA TRCN0000072259

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_159s1c1
DNA Barcode:
CGCTGAGTACTTCGAAATGTC
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 159 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 159 4.950 N/A
2 CONTROL -38 luc2 gi 115342883 bases 141-1793... luc2.1 89% CDS 159 N/A N/A
3 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 159 4.950 N/A
Download CSV

Sequence Information

Target Sequence:
CGCTGAGTACTTCGAAATGTC
Hairpin Sequence:
5'-CCGG-CGCTGAGTACTTCGAAATGTC-CTCGAG-GACATTTCGAAGTACTCAGCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGCTGAGTACTTCGAAATGTCCTCGAGGACATTTCGAAGTACTCAGCG-3'

Other clones with same target sequence:

  1. TRCN0000231715