Construct: shRNA TRCN0000072256

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_158s1c1
DNA Barcode:
ACGCTGAGTACTTCGAAATGT

Original Target:

Taxon:
Control
Gene:
LUCIFERASE (LUCIFERASE)
Gene Description:
promegaLuc
Transcript:
Broad promegaLuc.1 (CURRENT)
Match location:
Position 158 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072256)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL LUCIFERASE LUCIFERASE promegaLuc promegaLuc.1 100% CDS 158 5.625 N/A
2 CONTROL luc2 luc2 gi 115342883 bases 141-1793... luc2.1 89% CDS 158 N/A N/A
3 CONTROL Luciferase Luciferase Hahn Lab Luciferase Luciferase.1 100% CDS 158 5.625 N/A
4 mouse 106042 Prickle1 prickle planar cell polarit... NM_001033217.4 89% CDS 993 N/A N/A
5 mouse 106042 Prickle1 prickle planar cell polarit... XM_006520264.2 89% CDS 6052 N/A N/A
6 mouse 106042 Prickle1 prickle planar cell polarit... XM_006520265.1 89% CDS 1365 N/A N/A
7 mouse 106042 Prickle1 prickle planar cell polarit... XM_006520266.2 89% CDS 6049 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACGCTGAGTACTTCGAAATGT
Hairpin Sequence:
5'-CCGG-ACGCTGAGTACTTCGAAATGT-CTCGAG-ACATTTCGAAGTACTCAGCGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACGCTGAGTACTTCGAAATGTCTCGAGACATTTCGAAGTACTCAGCGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACGCTGAGTACTTCGAAATGTCTCGAGACATTTCGAAGTACTCAGCGT-3'

Other clones with same target sequence:

  1. TRCN0000231742