Construct: shRNA TRCN0000072255

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_601s1c1
DNA Barcode:
TCTACTGGTCTGCCTAAAGGT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 601 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 601 3.000 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 601 3.000 N/A
3 human 641746 LOC641746 glycine cleavage system pro... NR_033245.1 80% 3UTR 330 N/A N/A
4 human 100505743 LOC100505743 uncharacterized LOC100505743 XR_109545.1 78% 3UTR 943 N/A N/A
5 human 100505743 LOC100505743 uncharacterized LOC100505743 XR_111874.1 78% 3UTR 943 N/A N/A
6 mouse 381974 Mrgprg MAS-related GPR, member G NM_203492.2 89% CDS 616 N/A N/A
7 mouse 668489 Gm9199 glycine cleavage system pro... NR_027860.1 80% 3UTR 344 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TCTACTGGTCTGCCTAAAGGT
Hairpin Sequence:
5'-CCGG-TCTACTGGTCTGCCTAAAGGT-CTCGAG-ACCTTTAGGCAGACCAGTAGA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTCTACTGGTCTGCCTAAAGGTCTCGAGACCTTTAGGCAGACCAGTAGATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATCTACTGGTCTGCCTAAAGGTCTCGAGACCTTTAGGCAGACCAGTAGA-3'

Other clones with same target sequence:

  1. TRCN0000231734