Construct: shRNA TRCN0000072249

Construct Description:

Construct Type:
shRNA
Other Identifiers:
promegaLuc_976s1c1
DNA Barcode:
GCGGTTGCCAAGAGGTTCCAT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
promega LUCIFERASE
Gene Description:
promegaLuc
Transcript:
promega promegaLuc.1 (CURRENT)
Match location:
Position 976 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -14 LUCIFERASE promegaLuc promegaLuc.1 100% CDS 976 1.000 N/A
2 CONTROL -43 Luciferase Luciferase Luciferase.1 100% CDS 976 1.000 N/A
3 mouse 66161 Pop4 processing of precursor 4, ... NM_025390.4 85% CDS 816 N/A N/A
4 mouse 72259 1700030M09Rik RIKEN cDNA 1700030M09 gene NR_045903.1 85% 3UTR 497 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGGTTGCCAAGAGGTTCCAT
Hairpin Sequence:
5'-CCGG-GCGGTTGCCAAGAGGTTCCAT-CTCGAG-ATGGAACCTCTTGGCAACCGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGGTTGCCAAGAGGTTCCATCTCGAGATGGAACCTCTTGGCAACCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGGTTGCCAAGAGGTTCCATCTCGAGATGGAACCTCTTGGCAACCGC-3'

Other clones with same target sequence:

  1. TRCN0000231719