Construct: TRCN0000072234

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_14s1c1
DNA Barcode:
CGGATTCTCTGGCCGTCGTAT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
NCBI lacZ
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 14 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% 100% CDS 14 1.650 N/A
2 human 255725 OR52B2 olfactory receptor, family ... NM_001004052.1 77% 85% CDS 433 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGATTCTCTGGCCGTCGTAT
Hairpin Sequence:
5'-CCGG-CGGATTCTCTGGCCGTCGTAT-CTCGAG-ATACGACGGCCAGAGAATCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCG-3'

Other clones with same target sequence:

(none)