Construct: shRNA TRCN0000072234

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_14s1c1
DNA Barcode:
CGGATTCTCTGGCCGTCGTAT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
lacZ (-15)
Gene Description:
lacZ
Transcript:
Broad lacZ.1 (CURRENT)
Match location:
Position 14 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 14 1.650 N/A
2 human 255725 OR52B2 olfactory receptor, family ... NM_001004052.1 85% CDS 433 N/A N/A
3 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_428345.2 89% 3UTR 2793 N/A N/A
4 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_432306.2 89% 3UTR 2793 N/A N/A
5 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928881.1 89% 3UTR 2793 N/A N/A
6 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928883.1 89% 3UTR 2793 N/A N/A
7 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928884.1 89% 3UTR 2793 N/A N/A
8 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928885.1 89% 3UTR 2793 N/A N/A
9 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928886.1 89% 3UTR 2793 N/A N/A
10 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928887.1 89% 3UTR 2793 N/A N/A
11 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928888.1 89% 3UTR 2793 N/A N/A
12 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928890.1 89% 3UTR 2793 N/A N/A
13 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928892.1 89% 3UTR 2793 N/A N/A
14 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928893.1 89% 3UTR 2793 N/A N/A
15 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_928894.1 89% 3UTR 2793 N/A N/A
16 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956933.1 89% 3UTR 2793 N/A N/A
17 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956934.1 89% 3UTR 2793 N/A N/A
18 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956935.1 89% 3UTR 2793 N/A N/A
19 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956936.1 89% 3UTR 2793 N/A N/A
20 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956937.1 89% 3UTR 2793 N/A N/A
21 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956938.1 89% 3UTR 2793 N/A N/A
22 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956939.1 89% 3UTR 2793 N/A N/A
23 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956941.1 89% 3UTR 2793 N/A N/A
24 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956944.1 89% 3UTR 2793 N/A N/A
25 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956945.1 89% 3UTR 2793 N/A N/A
26 human 102724359 LOC102724359 uncharacterized LOC102724359 XR_956946.1 89% 3UTR 2793 N/A N/A
27 human 105369769 LOC105369769 uncharacterized LOC105369769 XR_914121.1 89% 3UTR 300 N/A N/A
28 human 105378249 LOC105378249 uncharacterized LOC105378249 XR_944959.1 89% 3UTR 300 N/A N/A
29 mouse 102632594 LOC102632594 uncharacterized LOC102632594 XR_874396.1 85% 3UTR 3667 N/A N/A
30 mouse 102632594 LOC102632594 uncharacterized LOC102632594 XR_876557.1 85% 3UTR 3667 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGATTCTCTGGCCGTCGTAT
Hairpin Sequence:
5'-CCGG-CGGATTCTCTGGCCGTCGTAT-CTCGAG-ATACGACGGCCAGAGAATCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGATTCTCTGGCCGTCGTATCTCGAGATACGACGGCCAGAGAATCCG-3'

Other clones with same target sequence:

(none)