Construct: shRNA TRCN0000072233

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_656s1c1
DNA Barcode:
CGACCACGCAAATCAGCGATT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
lacZ (-15)
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 656 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 656 4.050 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 89% CDS 641 N/A N/A
3 human 491 ATP2B2 ATPase, Ca++ transporting, ... NM_001001331.2 85% CDS 4102 N/A N/A
4 human 491 ATP2B2 ATPase, Ca++ transporting, ... NM_001683.3 85% CDS 3967 N/A N/A
5 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_005265179.2 85% CDS 4209 N/A N/A
6 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_006713175.1 85% CDS 4163 N/A N/A
7 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_006713176.1 85% CDS 4141 N/A N/A
8 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_006713177.1 85% CDS 4130 N/A N/A
9 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_006713178.1 85% CDS 4070 N/A N/A
10 human 491 ATP2B2 ATPase, Ca++ transporting, ... XM_006713181.1 85% CDS 4028 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGACCACGCAAATCAGCGATT
Hairpin Sequence:
5'-CCGG-CGACCACGCAAATCAGCGATT-CTCGAG-AATCGCTGATTTGCGTGGTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGACCACGCAAATCAGCGATTCTCGAGAATCGCTGATTTGCGTGGTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGACCACGCAAATCAGCGATTCTCGAGAATCGCTGATTTGCGTGGTCG-3'

Other clones with same target sequence:

  1. TRCN0000231716