Construct: shRNA TRCN0000072231

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_1650s1c1
DNA Barcode:
CGCTAAATACTGGCAGGCGTT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
NCBI lacZ
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 1650 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 1650 2.160 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 100% CDS 1635 2.160 N/A
3 human 100289673 LOC100289673 phosphoglycerate mutase fam... NR_033175.1 85% 3UTR 1241 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGCTAAATACTGGCAGGCGTT
Hairpin Sequence:
5'-CCGG-CGCTAAATACTGGCAGGCGTT-CTCGAG-AACGCCTGCCAGTATTTAGCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGCTAAATACTGGCAGGCGTTCTCGAGAACGCCTGCCAGTATTTAGCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGCTAAATACTGGCAGGCGTTCTCGAGAACGCCTGCCAGTATTTAGCG-3'

Other clones with same target sequence:

  1. TRCN0000231710