Construct: shRNA TRCN0000072228

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_2082s1c1
DNA Barcode:
ACTCTGGCTAACGGTACGCGT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
NCBI lacZ
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 2082 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 2082 0.220 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 89% CDS 2067 N/A N/A
3 mouse 102632 Acad11 acyl-Coenzyme A dehydrogena... NM_175324.3 85% CDS 2270 N/A N/A
4 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_381867.1 85% 3UTR 1799 N/A N/A
5 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_381868.1 85% 3UTR 1296 N/A N/A
6 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_381869.1 85% 3UTR 1169 N/A N/A
7 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_394755.1 85% 3UTR 1799 N/A N/A
8 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_394756.1 85% 3UTR 1296 N/A N/A
9 mouse 102632708 LOC102632708 uncharacterized LOC102632708 XR_394757.1 85% 3UTR 1169 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACTCTGGCTAACGGTACGCGT
Hairpin Sequence:
5'-CCGG-ACTCTGGCTAACGGTACGCGT-CTCGAG-ACGCGTACCGTTAGCCAGAGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACTCTGGCTAACGGTACGCGTCTCGAGACGCGTACCGTTAGCCAGAGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACTCTGGCTAACGGTACGCGTCTCGAGACGCGTACCGTTAGCCAGAGT-3'

Other clones with same target sequence:

  1. TRCN0000231713