Construct: shRNA TRCN0000072227

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_1397s1c1
DNA Barcode:
GCGCTAATCACGACGCGCTGT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
lacZ (-15)
Gene Description:
lacZ
Transcript:
NCBI lacZ.1 (CURRENT)
Match location:
Position 1397 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 1397 0.000 N/A
2 CONTROL -42 LacZ LacZ LacZ.1 100% CDS 1382 0.000 N/A
Download CSV

Sequence Information

Target Sequence:
GCGCTAATCACGACGCGCTGT
Hairpin Sequence:
5'-CCGG-GCGCTAATCACGACGCGCTGT-CTCGAG-ACAGCGCGTCGTGATTAGCGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGCTAATCACGACGCGCTGTCTCGAGACAGCGCGTCGTGATTAGCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGCTAATCACGACGCGCTGTCTCGAGACAGCGCGTCGTGATTAGCGC-3'

Other clones with same target sequence:

  1. TRCN0000231708