Construct: shRNA TRCN0000072221

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_407s1c1
DNA Barcode:
TGCAGAAGAAGACCATGGGCT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 407 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 407 0.660 N/A
2 human 23304 UBR2 ubiquitin protein ligase E3... NM_015255.2 89% 3UTR 6107 N/A N/A
3 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248965.2 89% 3UTR 6115 N/A N/A
4 human 23304 UBR2 ubiquitin protein ligase E3... XM_005248966.1 89% 3UTR 3776 N/A N/A
5 human 124222 PAQR4 progestin and adipoQ recept... NM_001284511.1 89% 3UTR 2039 N/A N/A
6 human 124222 PAQR4 progestin and adipoQ recept... NM_001284512.1 89% 3UTR 1934 N/A N/A
7 human 124222 PAQR4 progestin and adipoQ recept... NM_001284513.1 89% 3UTR 1662 N/A N/A
8 human 124222 PAQR4 progestin and adipoQ recept... NM_152341.4 89% 3UTR 2156 N/A N/A
9 human 124222 PAQR4 progestin and adipoQ recept... XM_005255112.1 89% 3UTR 1859 N/A N/A
10 human 84074 QRICH2 glutamine rich 2 NM_032134.1 86% CDS 312 N/A N/A
11 human 84074 QRICH2 glutamine rich 2 XM_005257728.1 86% CDS 1322 N/A N/A
12 mouse 75753 Klf17 Kruppel-like factor 17 NM_029416.2 89% 3UTR 2885 N/A N/A
13 mouse 230866 Emc1 ER membrane protein complex... NM_001039200.2 89% CDS 2357 N/A N/A
14 mouse 230866 Emc1 ER membrane protein complex... NM_146157.4 89% CDS 2366 N/A N/A
15 mouse 28064 Yipf3 Yip1 domain family, member 3 NM_145353.2 89% CDS 372 N/A N/A
16 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_006524377.1 89% CDS 411 N/A N/A
17 mouse 28064 Yipf3 Yip1 domain family, member 3 XM_006524378.1 89% 5UTR 331 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGCAGAAGAAGACCATGGGCT
Hairpin Sequence:
5'-CCGG-TGCAGAAGAAGACCATGGGCT-CTCGAG-AGCCCATGGTCTTCTTCTGCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGCAGAAGAAGACCATGGGCTCTCGAGAGCCCATGGTCTTCTTCTGCA-3'

Other clones with same target sequence:

  1. TRCN0000231687