Construct: shRNA TRCN0000072218

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_66s1c1
DNA Barcode:
GAACGGCCACGAGTTCGAGAT
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 66 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 66 1.350 N/A
2 mouse 12412 Cbx1 chromobox 1 XM_006532097.1 89% 5UTR 182 N/A N/A
3 mouse 12412 Cbx1 chromobox 1 XM_006532098.1 89% 5UTR 182 N/A N/A
4 mouse 12412 Cbx1 chromobox 1 XM_006532099.1 89% 5UTR 182 N/A N/A
5 mouse 12412 Cbx1 chromobox 1 XM_006532100.1 89% 5UTR 182 N/A N/A
6 mouse 12412 Cbx1 chromobox 1 XM_006532101.1 89% 5UTR 182 N/A N/A
7 mouse 12412 Cbx1 chromobox 1 XM_006532102.1 89% 5UTR 182 N/A N/A
8 mouse 12412 Cbx1 chromobox 1 XR_388342.1 89% 3UTR 182 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GAACGGCCACGAGTTCGAGAT
Hairpin Sequence:
5'-CCGG-GAACGGCCACGAGTTCGAGAT-CTCGAG-ATCTCGAACTCGTGGCCGTTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGAACGGCCACGAGTTCGAGATCTCGAGATCTCGAACTCGTGGCCGTTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGAACGGCCACGAGTTCGAGATCTCGAGATCTCGAACTCGTGGCCGTTC-3'

Other clones with same target sequence:

  1. TRCN0000231691