Construct: shRNA TRCN0000072216

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_513s1c1
DNA Barcode:
CCACTACGACGCCGAGGTCAA
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 513 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 513 0.000 N/A
2 mouse 237436 Gas2l3 growth arrest-specific 2 li... NM_001033331.2 89% CDS 1899 N/A N/A
3 mouse 237436 Gas2l3 growth arrest-specific 2 li... NM_001079876.1 89% CDS 1902 N/A N/A
4 mouse 100502876 Kcnmb3 potassium large conductance... NM_001195074.1 89% CDS 399 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCACTACGACGCCGAGGTCAA
Hairpin Sequence:
5'-CCGG-CCACTACGACGCCGAGGTCAA-CTCGAG-TTGACCTCGGCGTCGTAGTGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCACTACGACGCCGAGGTCAACTCGAGTTGACCTCGGCGTCGTAGTGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCACTACGACGCCGAGGTCAACTCGAGTTGACCTCGGCGTCGTAGTGG-3'

Other clones with same target sequence:

  1. TRCN0000231694