Construct: shRNA TRCN0000072215

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_403s1c1
DNA Barcode:
GTAATGCAGAAGAAGACCATG
Vector:
pLKO.1

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 403 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 403 4.050 N/A
2 human 26273 FBXO3 F-box protein 3 XM_011519980.1 89% CDS 1357 N/A N/A
3 human 26273 FBXO3 F-box protein 3 XM_011519982.1 89% CDS 1411 N/A N/A
4 human 81609 SNX27 sorting nexin family member 27 XM_005245509.1 85% 3UTR 3553 N/A N/A
5 human 81609 SNX27 sorting nexin family member 27 XM_005245510.1 85% 3UTR 3160 N/A N/A
6 human 81609 SNX27 sorting nexin family member 27 XM_005245511.2 85% 3UTR 4301 N/A N/A
7 human 81609 SNX27 sorting nexin family member 27 XM_005245512.2 85% 3UTR 3259 N/A N/A
8 human 55815 TSNAXIP1 translin-associated factor ... NM_001288990.1 89% CDS 1218 N/A N/A
9 human 55815 TSNAXIP1 translin-associated factor ... NM_001288991.1 89% CDS 1011 N/A N/A
10 human 55815 TSNAXIP1 translin-associated factor ... NM_001288992.1 89% 5UTR 884 N/A N/A
11 human 55815 TSNAXIP1 translin-associated factor ... NM_001288993.1 89% 5UTR 1011 N/A N/A
12 human 55815 TSNAXIP1 translin-associated factor ... NM_001288994.1 89% 5UTR 687 N/A N/A
13 human 55815 TSNAXIP1 translin-associated factor ... NM_018430.3 89% CDS 1407 N/A N/A
14 human 55815 TSNAXIP1 translin-associated factor ... XM_005256049.3 89% CDS 1440 N/A N/A
15 human 55815 TSNAXIP1 translin-associated factor ... XM_011523230.1 89% CDS 1440 N/A N/A
16 human 55815 TSNAXIP1 translin-associated factor ... XM_011523231.1 89% CDS 1440 N/A N/A
17 human 55815 TSNAXIP1 translin-associated factor ... XM_011523232.1 89% CDS 1440 N/A N/A
18 human 55815 TSNAXIP1 translin-associated factor ... XM_011523233.1 89% CDS 1440 N/A N/A
19 human 55815 TSNAXIP1 translin-associated factor ... XM_011523234.1 89% CDS 1440 N/A N/A
20 human 55815 TSNAXIP1 translin-associated factor ... XM_011523235.1 89% CDS 1158 N/A N/A
21 human 55815 TSNAXIP1 translin-associated factor ... XM_011523236.1 89% CDS 794 N/A N/A
22 human 55815 TSNAXIP1 translin-associated factor ... XM_011523237.1 89% CDS 797 N/A N/A
23 human 55815 TSNAXIP1 translin-associated factor ... XM_011523238.1 89% CDS 696 N/A N/A
24 human 55815 TSNAXIP1 translin-associated factor ... XM_011523239.1 89% CDS 697 N/A N/A
25 human 55815 TSNAXIP1 translin-associated factor ... XM_011523240.1 89% CDS 883 N/A N/A
26 human 55815 TSNAXIP1 translin-associated factor ... XM_011523241.1 89% CDS 971 N/A N/A
27 human 55815 TSNAXIP1 translin-associated factor ... XM_011523242.1 89% CDS 824 N/A N/A
28 human 55815 TSNAXIP1 translin-associated factor ... XM_011523243.1 89% CDS 778 N/A N/A
29 mouse 215446 Entpd3 ectonucleoside triphosphate... NM_178676.4 86% 3UTR 1964 N/A N/A
30 mouse 320333 D830030K20Rik RIKEN cDNA D830030K20 gene XR_382955.1 89% 3UTR 730 N/A N/A
31 mouse 320333 D830030K20Rik RIKEN cDNA D830030K20 gene XR_382956.1 89% 3UTR 730 N/A N/A
32 mouse 545007 Gm5796 predicted gene 5796 XM_006518067.1 89% CDS 626 N/A N/A
33 mouse 623078 Gm8108 predicted gene 8108 XR_383051.1 89% 3UTR 459 N/A N/A
34 mouse 622931 Gm10021 predicted gene 10021 XR_032520.3 89% 3UTR 461 N/A N/A
35 mouse 622931 Gm10021 predicted gene 10021 XR_383015.1 89% 3UTR 455 N/A N/A
36 mouse 666800 Gm8297 predicted gene 8297 XR_383027.1 89% 3UTR 1331 N/A N/A
37 mouse 100038847 Gm10406 predicted gene 10406 XM_006517819.1 89% CDS 2531 N/A N/A
38 mouse 100040870 Gm3012 predicted gene 3012 XM_006518262.1 89% CDS 622 N/A N/A
39 mouse 100041774 Gm10413 predicted gene 10413 XM_006517861.1 89% CDS 954 N/A N/A
40 mouse 75827 4930542N06Rik RIKEN cDNA 4930542N06 gene XR_389450.1 85% 3UTR 1789 N/A N/A
41 mouse 75827 4930542N06Rik RIKEN cDNA 4930542N06 gene XR_402723.1 85% 3UTR 1652 N/A N/A
42 mouse 100036569 Gm16525 predicted gene, 16525 XR_382976.1 89% 3UTR 3237 N/A N/A
43 mouse 100036569 Gm16525 predicted gene, 16525 XR_382980.1 89% 3UTR 597 N/A N/A
44 mouse 100042149 Gm3696 predicted gene 3696 XM_006517884.1 89% CDS 812 N/A N/A
45 mouse 102634558 Gm32109 predicted gene, 32109 XR_386577.1 89% 3UTR 596 N/A N/A
46 mouse 102638538 LOC102638538 protein argonaute 12-like XM_006518200.1 89% 3UTR 740 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTAATGCAGAAGAAGACCATG
Hairpin Sequence:
5'-CCGG-GTAATGCAGAAGAAGACCATG-CTCGAG-CATGGTCTTCTTCTGCATTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTAC-3'

Other clones with same target sequence:

  1. TRCN0000231696