Construct: TRCN0000072215

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_403s1c1
DNA Barcode:
GTAATGCAGAAGAAGACCATG
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 403 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 403 4.050 N/A
2 human 6091 ROBO1 axon guidance receptor NM_001145845.1 78% 85% CDS 5058 N/A N/A
3 human 6091 ROBO1 axon guidance receptor NM_002941.3 78% 85% CDS 4568 N/A N/A
4 human 390792 KRT39 type I hair keratin KA35 NM_213656.3 90% 89% CDS 317 N/A N/A
5 human 55815 TSNAXIP1 translin-associated factor ... NM_018430.2 80% 89% CDS 1178 N/A N/A
6 human 442459 LOC442459 X-ray repair complementing ... NR_024608.1 81% 85% 3UTR 1237 N/A N/A
7 mouse 215446 Entpd3 CD39 antigenlike 3 NM_178676.4 82% 85% 3UTR 1964 N/A N/A
8 mouse 53617 Krt35 hair keratin acidic 5 NM_016880.2 90% 89% CDS 322 N/A N/A
9 mouse 406221 Krt40 ortholog of type I hair ker... NM_001039666.1 90% 89% CDS 260 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GTAATGCAGAAGAAGACCATG
Hairpin Sequence:
5'-CCGG-GTAATGCAGAAGAAGACCATG-CTCGAG-CATGGTCTTCTTCTGCATTAC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTACTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGTAATGCAGAAGAAGACCATGCTCGAGCATGGTCTTCTTCTGCATTAC-3'

Other clones with same target sequence:

  1. TRCN0000231696