Construct: TRCN0000072213

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_620s1c1
DNA Barcode:
ACTACACCATCGTGGAACAGT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 620 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 620 3.000 N/A
2 human 94104 GCFC1 GCrich sequence DNAbinding ... NR_027873.1 78% 80% 3UTR 2232 N/A N/A
3 human 6332 SCN7A sodium channel, voltagegate... NR_045628.1 78% 80% 3UTR 4150 N/A N/A
4 human 6331 SCN5A cardiac sodium channel alph... NM_000335.4 85% 94% CDS 4312 N/A N/A
5 human 6331 SCN5A cardiac sodium channel alph... NM_001099404.1 85% 94% CDS 4315 N/A N/A
6 human 6331 SCN5A cardiac sodium channel alph... NM_001099405.1 85% 94% CDS 4315 N/A N/A
7 human 6331 SCN5A cardiac sodium channel alph... NM_001160160.1 85% 94% CDS 4313 N/A N/A
8 human 6331 SCN5A cardiac sodium channel alph... NM_001160161.1 85% 94% CDS 4154 N/A N/A
9 human 6331 SCN5A cardiac sodium channel alph... NM_198056.2 85% 94% CDS 4315 N/A N/A
10 human 3691 ITGB4 CD104 antigen NM_000213.3 86% 85% CDS 2826 N/A N/A
11 human 3691 ITGB4 CD104 antigen NM_001005619.1 86% 85% CDS 2647 N/A N/A
12 human 3691 ITGB4 CD104 antigen NM_001005731.1 86% 85% CDS 2826 N/A N/A
13 human 80233 C17orf70 Fanconi anemia associated p... NR_033338.1 75% 77% 3UTR 1960 N/A N/A
14 mouse 20271 Scn5a sodium channel, voltagegate... NM_001253860.1 80% 89% CDS 4184 N/A N/A
15 mouse 20271 Scn5a sodium channel, voltagegate... NM_021544.4 80% 89% CDS 4352 N/A N/A
16 mouse 192897 Itgb4 integrin beta 4 NM_001005608.2 86% 85% CDS 3082 N/A N/A
17 mouse 192897 Itgb4 integrin beta 4 NM_133663.2 86% 85% CDS 3082 N/A N/A
Download CSV

Sequence Information

Target Sequence:
ACTACACCATCGTGGAACAGT
Hairpin Sequence:
5'-CCGG-ACTACACCATCGTGGAACAGT-CTCGAG-ACTGTTCCACGATGGTGTAGT-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGACTACACCATCGTGGAACAGTCTCGAGACTGTTCCACGATGGTGTAGTTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAACTACACCATCGTGGAACAGTCTCGAGACTGTTCCACGATGGTGTAGT-3'

Other clones with same target sequence:

  1. TRCN0000231725