Construct: shRNA TRCN0000072212

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_401s1c1
DNA Barcode:
CCGTAATGCAGAAGAAGACCA

Original Target:

Taxon:
Control
Gene:
RFP (-12)
Gene Description:
RFP
Transcript:
Broad rfp.1 (CURRENT)
Match location:
Position 401 (CDS)

Vector Information:

Vector Backbone:
pLKO.1
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000072212)
Selection Marker:
PuroR
Visible Reporter:
n/a

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 401 2.640 N/A
2 mouse 434215 Lrrc32 leucine rich repeat contain... NM_001113379.1 89% 3UTR 3505 N/A N/A
3 mouse 434215 Lrrc32 leucine rich repeat contain... XM_006507977.1 89% 3UTR 3634 N/A N/A
4 mouse 434215 Lrrc32 leucine rich repeat contain... XM_006507978.2 89% 3UTR 3610 N/A N/A
5 mouse 434215 Lrrc32 leucine rich repeat contain... XM_006507979.2 89% 3UTR 3607 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCGTAATGCAGAAGAAGACCA
Hairpin Sequence:
5'-CCGG-CCGTAATGCAGAAGAAGACCA-CTCGAG-TGGTCTTCTTCTGCATTACGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCGTAATGCAGAAGAAGACCACTCGAGTGGTCTTCTTCTGCATTACGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCGTAATGCAGAAGAAGACCACTCGAGTGGTCTTCTTCTGCATTACGG-3'

Other clones with same target sequence:

  1. TRCN0000231724