Construct: shRNA TRCN0000072212

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_401s1c1
DNA Barcode:
CCGTAATGCAGAAGAAGACCA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 401 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 401 2.640 N/A
2 human 6091 ROBO1 roundabout, axon guidance r... NM_001145845.1 85% CDS 5056 N/A N/A
3 human 6091 ROBO1 roundabout, axon guidance r... NM_002941.3 85% CDS 4566 N/A N/A
4 human 6091 ROBO1 roundabout, axon guidance r... NM_133631.3 85% CDS 5221 N/A N/A
5 human 139596 UPRT uracil phosphoribosyltransf... NR_030774.1 80% 3UTR 1803 N/A N/A
6 mouse 434215 Lrrc32 leucine rich repeat contain... NM_001113379.1 89% 3UTR 3505 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCGTAATGCAGAAGAAGACCA
Hairpin Sequence:
5'-CCGG-CCGTAATGCAGAAGAAGACCA-CTCGAG-TGGTCTTCTTCTGCATTACGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCGTAATGCAGAAGAAGACCACTCGAGTGGTCTTCTTCTGCATTACGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCGTAATGCAGAAGAAGACCACTCGAGTGGTCTTCTTCTGCATTACGG-3'

Other clones with same target sequence:

  1. TRCN0000231724