Construct: shRNA TRCN0000072211

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_621s1c1
DNA Barcode:
CTACACCATCGTGGAACAGTA
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 621 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% CDS 621 4.950 N/A
2 human 6331 SCN5A sodium channel, voltage-gat... NM_000335.4 89% CDS 4313 N/A N/A
3 human 6331 SCN5A sodium channel, voltage-gat... NM_001099404.1 89% CDS 4316 N/A N/A
4 human 6331 SCN5A sodium channel, voltage-gat... NM_001099405.1 89% CDS 4316 N/A N/A
5 human 6331 SCN5A sodium channel, voltage-gat... NM_001160160.1 89% CDS 4314 N/A N/A
6 human 6331 SCN5A sodium channel, voltage-gat... NM_001160161.1 89% CDS 4155 N/A N/A
7 human 6331 SCN5A sodium channel, voltage-gat... NM_198056.2 89% CDS 4316 N/A N/A
8 human 3691 ITGB4 integrin, beta 4 NM_000213.3 85% CDS 2827 N/A N/A
9 human 3691 ITGB4 integrin, beta 4 NM_001005619.1 85% CDS 2648 N/A N/A
10 human 3691 ITGB4 integrin, beta 4 NM_001005731.1 85% CDS 2827 N/A N/A
11 human 80233 C17orf70 chromosome 17 open reading ... NR_033338.1 81% 3UTR 1961 N/A N/A
12 mouse 192897 Itgb4 integrin beta 4 NM_001005608.2 85% CDS 3083 N/A N/A
13 mouse 192897 Itgb4 integrin beta 4 NM_133663.2 85% CDS 3083 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACACCATCGTGGAACAGTA
Hairpin Sequence:
5'-CCGG-CTACACCATCGTGGAACAGTA-CTCGAG-TACTGTTCCACGATGGTGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACACCATCGTGGAACAGTACTCGAGTACTGTTCCACGATGGTGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACACCATCGTGGAACAGTACTCGAGTACTGTTCCACGATGGTGTAG-3'

Other clones with same target sequence:

  1. TRCN0000231723