Construct: TRCN0000072210

Construct Description:

Construct Type:
shRNA
Other Identifiers:
rfp_402s1c1
DNA Barcode:
CGTAATGCAGAAGAAGACCAT
Vector:
pLKO.1

Original Target:

Taxon:
CONTROL
Gene:
tsien lab genbank RFP
Gene Description:
RFP
Transcript:
tsien lab genbank rfp.1 (CURRENT)
Match location:
Position 402 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -12 RFP RFP rfp.1 100% 100% CDS 402 2.640 N/A
2 human 9590 AKAP12 Akinase anchor protein 12 NM_005100.3 77% 85% CDS 3060 N/A N/A
3 human 9590 AKAP12 Akinase anchor protein 12 NM_144497.2 77% 85% CDS 2856 N/A N/A
4 human 6091 ROBO1 axon guidance receptor NM_001145845.1 82% 85% CDS 5057 N/A N/A
5 human 6091 ROBO1 axon guidance receptor NM_002941.3 82% 85% CDS 4567 N/A N/A
6 human 6091 ROBO1 axon guidance receptor NM_133631.3 82% 85% CDS 5222 N/A N/A
7 mouse 215446 Entpd3 CD39 antigenlike 3 NM_178676.4 78% 80% 3UTR 1963 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGTAATGCAGAAGAAGACCAT
Hairpin Sequence:
5'-CCGG-CGTAATGCAGAAGAAGACCAT-CTCGAG-ATGGTCTTCTTCTGCATTACG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGTAATGCAGAAGAAGACCATCTCGAGATGGTCTTCTTCTGCATTACGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGTAATGCAGAAGAAGACCATCTCGAGATGGTCTTCTTCTGCATTACG-3'

Other clones with same target sequence:

  1. TRCN0000231690